Incidental Mutation 'R1741:Hltf'
ID 200327
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Name helicase-like transcription factor
Synonyms Snf2l3, Smarca3, P113
MMRRC Submission 039773-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 20111975-20172654 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20140352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 422 (W422R)
Ref Sequence ENSEMBL: ENSMUSP00000118775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
AlphaFold Q6PCN7
Predicted Effect probably damaging
Transcript: ENSMUST00000002502
AA Change: W484R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: W484R

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably damaging
Transcript: ENSMUST00000143005
AA Change: W484R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428
AA Change: W484R

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145853
AA Change: W422R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428
AA Change: W422R

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,793,578 (GRCm39) N37S probably damaging Het
Acad10 T C 5: 121,785,899 (GRCm39) K230R probably damaging Het
Actl7a A G 4: 56,744,252 (GRCm39) N260D probably benign Het
Adam24 T C 8: 41,132,642 (GRCm39) Y37H probably benign Het
Ahcy G A 2: 154,906,154 (GRCm39) A229V probably benign Het
Ap3b2 A G 7: 81,117,347 (GRCm39) V563A possibly damaging Het
Bcl9l T A 9: 44,420,986 (GRCm39) M1427K probably damaging Het
Btf3 C T 13: 98,452,804 (GRCm39) M1I probably null Het
Btg4 A T 9: 51,027,910 (GRCm39) I27L probably benign Het
Ccdc171 A G 4: 83,539,076 (GRCm39) Y366C probably damaging Het
Chd3 A G 11: 69,246,480 (GRCm39) Y1085H probably damaging Het
Cnot10 T C 9: 114,426,892 (GRCm39) D616G possibly damaging Het
Crlf1 C A 8: 70,953,556 (GRCm39) D243E probably damaging Het
Cyp2b23 A G 7: 26,372,502 (GRCm39) V371A possibly damaging Het
Dennd2a A G 6: 39,470,091 (GRCm39) S534P probably damaging Het
Eln A G 5: 134,758,038 (GRCm39) V185A unknown Het
Epor C T 9: 21,871,067 (GRCm39) G301D probably damaging Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Fbxl21 A T 13: 56,684,915 (GRCm39) T340S probably benign Het
Fcgbpl1 G T 7: 27,857,279 (GRCm39) C2209F probably damaging Het
Fez1 T A 9: 36,755,029 (GRCm39) D9E probably damaging Het
Fsip2 T C 2: 82,820,256 (GRCm39) F5330L probably benign Het
Glis1 G A 4: 107,425,544 (GRCm39) R197Q probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gpr158 A G 2: 21,832,359 (GRCm39) N1153S probably benign Het
Gramd4 T C 15: 85,975,730 (GRCm39) probably null Het
Hhatl T A 9: 121,618,125 (GRCm39) Y210F possibly damaging Het
Hspa5 T C 2: 34,662,704 (GRCm39) S87P possibly damaging Het
Il21 T C 3: 37,281,811 (GRCm39) H111R probably benign Het
Ip6k1 G A 9: 107,918,183 (GRCm39) G73S probably benign Het
Kdm5b A G 1: 134,545,755 (GRCm39) D972G possibly damaging Het
Kif21b C T 1: 136,083,880 (GRCm39) A709V probably damaging Het
Kmt2d T C 15: 98,743,115 (GRCm39) probably benign Het
Lrrc14b A G 13: 74,511,705 (GRCm39) L125P probably damaging Het
Mapk8ip3 A G 17: 25,118,828 (GRCm39) S1169P probably damaging Het
Me3 A T 7: 89,501,041 (GRCm39) Y584F probably damaging Het
Mxra7 T G 11: 116,707,070 (GRCm39) probably null Het
Nf1 T C 11: 79,334,757 (GRCm39) S870P probably benign Het
Npr2 G A 4: 43,643,350 (GRCm39) G525S probably damaging Het
Nyap1 A T 5: 137,731,387 (GRCm39) S726T probably damaging Het
Padi4 A G 4: 140,473,481 (GRCm39) V652A probably damaging Het
Pclo A G 5: 14,726,524 (GRCm39) probably benign Het
Pgm1 G A 4: 99,822,062 (GRCm39) probably null Het
Piezo2 A G 18: 63,154,244 (GRCm39) S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 (GRCm39) D386E probably damaging Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 (GRCm39) V154A probably damaging Het
Rassf4 T C 6: 116,616,450 (GRCm39) E287G probably damaging Het
Rnh1 C T 7: 140,743,936 (GRCm39) R174H probably benign Het
Scn9a T A 2: 66,317,938 (GRCm39) I1517F probably damaging Het
Sftpb C A 6: 72,282,797 (GRCm39) A90E probably benign Het
Slc39a14 T C 14: 70,556,193 (GRCm39) K61R probably damaging Het
Tmem132d A C 5: 127,861,922 (GRCm39) M733R probably benign Het
Tmem248 A G 5: 130,265,664 (GRCm39) I156V probably benign Het
Traf2 T C 2: 25,414,495 (GRCm39) D339G probably damaging Het
Trappc11 A G 8: 47,982,362 (GRCm39) probably null Het
Tuba8 T A 6: 121,199,727 (GRCm39) I137N possibly damaging Het
Txlnb A G 10: 17,714,695 (GRCm39) T376A probably damaging Het
Usp34 A G 11: 23,314,103 (GRCm39) T663A probably benign Het
Vmn2r26 T A 6: 124,038,431 (GRCm39) F669I probably damaging Het
Wdr95 G A 5: 149,518,861 (GRCm39) probably null Het
Wfdc8 T G 2: 164,450,789 (GRCm39) probably benign Het
Zfp64 A C 2: 168,768,238 (GRCm39) V458G probably benign Het
Zfp868 C T 8: 70,064,519 (GRCm39) G272D probably damaging Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20,159,796 (GRCm39) splice site probably benign
IGL01461:Hltf APN 3 20,154,103 (GRCm39) nonsense probably null
IGL01630:Hltf APN 3 20,137,068 (GRCm39) splice site probably benign
IGL01704:Hltf APN 3 20,137,910 (GRCm39) splice site probably benign
IGL02059:Hltf APN 3 20,160,621 (GRCm39) missense probably benign
IGL02105:Hltf APN 3 20,146,921 (GRCm39) missense probably damaging 1.00
IGL02156:Hltf APN 3 20,146,971 (GRCm39) missense possibly damaging 0.61
IGL02870:Hltf APN 3 20,154,037 (GRCm39) missense probably damaging 0.98
IGL02899:Hltf APN 3 20,153,981 (GRCm39) missense probably damaging 1.00
IGL02935:Hltf APN 3 20,123,215 (GRCm39) missense probably damaging 1.00
IGL02950:Hltf APN 3 20,130,736 (GRCm39) missense probably benign 0.07
IGL03082:Hltf APN 3 20,118,723 (GRCm39) splice site probably benign
snarky UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R0068:Hltf UTSW 3 20,113,254 (GRCm39) missense probably damaging 1.00
R0787:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R0905:Hltf UTSW 3 20,163,033 (GRCm39) critical splice donor site probably null
R0980:Hltf UTSW 3 20,145,665 (GRCm39) missense probably benign 0.00
R1748:Hltf UTSW 3 20,130,685 (GRCm39) missense probably benign 0.13
R1799:Hltf UTSW 3 20,159,855 (GRCm39) missense probably damaging 1.00
R1976:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R2171:Hltf UTSW 3 20,113,245 (GRCm39) missense probably damaging 1.00
R2395:Hltf UTSW 3 20,146,906 (GRCm39) missense probably benign 0.41
R2444:Hltf UTSW 3 20,118,071 (GRCm39) missense possibly damaging 0.66
R3789:Hltf UTSW 3 20,123,211 (GRCm39) missense probably damaging 1.00
R3943:Hltf UTSW 3 20,146,908 (GRCm39) missense probably damaging 1.00
R4719:Hltf UTSW 3 20,118,865 (GRCm39) critical splice donor site probably null
R4793:Hltf UTSW 3 20,118,114 (GRCm39) missense possibly damaging 0.79
R5296:Hltf UTSW 3 20,162,276 (GRCm39) missense probably damaging 0.99
R5449:Hltf UTSW 3 20,123,247 (GRCm39) missense possibly damaging 0.92
R5492:Hltf UTSW 3 20,152,231 (GRCm39) splice site probably null
R6012:Hltf UTSW 3 20,113,098 (GRCm39) missense probably damaging 1.00
R6157:Hltf UTSW 3 20,130,660 (GRCm39) missense probably benign 0.13
R6254:Hltf UTSW 3 20,117,993 (GRCm39) missense possibly damaging 0.85
R6553:Hltf UTSW 3 20,126,558 (GRCm39) missense probably damaging 0.96
R6616:Hltf UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R6696:Hltf UTSW 3 20,119,470 (GRCm39) splice site probably null
R6761:Hltf UTSW 3 20,137,996 (GRCm39) critical splice donor site probably null
R6781:Hltf UTSW 3 20,152,330 (GRCm39) missense probably benign 0.00
R7241:Hltf UTSW 3 20,119,556 (GRCm39) missense probably benign 0.07
R7356:Hltf UTSW 3 20,163,534 (GRCm39) missense probably damaging 1.00
R7453:Hltf UTSW 3 20,136,916 (GRCm39) missense possibly damaging 0.81
R7765:Hltf UTSW 3 20,145,647 (GRCm39) missense probably benign 0.02
R7978:Hltf UTSW 3 20,146,968 (GRCm39) missense probably damaging 1.00
R8299:Hltf UTSW 3 20,136,986 (GRCm39) missense possibly damaging 0.73
R8547:Hltf UTSW 3 20,152,291 (GRCm39) missense probably damaging 1.00
R8857:Hltf UTSW 3 20,159,825 (GRCm39) missense probably damaging 0.98
R8859:Hltf UTSW 3 20,119,566 (GRCm39) nonsense probably null
R8926:Hltf UTSW 3 20,123,323 (GRCm39) critical splice donor site probably null
R8959:Hltf UTSW 3 20,136,936 (GRCm39) missense probably damaging 1.00
R9052:Hltf UTSW 3 20,152,246 (GRCm39) missense probably damaging 1.00
R9214:Hltf UTSW 3 20,140,280 (GRCm39) missense probably benign 0.01
R9405:Hltf UTSW 3 20,137,094 (GRCm39) missense possibly damaging 0.88
R9565:Hltf UTSW 3 20,136,996 (GRCm39) critical splice donor site probably null
X0027:Hltf UTSW 3 20,121,553 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCCACCTTCAGCCCATAAAATTCTT -3'
(R):5'- TTGGTGACCACATTCAAGCTCTCTC -3'

Sequencing Primer
(F):5'- TGTAGATGATGATTGCTGAGACC -3'
(R):5'- gccctaatcaagtaaattaacctctc -3'
Posted On 2014-05-23