Mutagenetix > Incidental Mutations

Incidental Mutation 'R1741:Ptpn3'

200331

Institutional Source

Beutler Lab

Gene Symbol

Ptpn3

Ensembl Gene

ENSMUSG00000038764

Gene Name

protein tyrosine phosphatase, non-receptor type 3

Synonyms

9530011I20Rik, PTPCL, PTP-H1

MMRRC Submission

039773-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.362) question?

Stock #

R1741 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

57190841-57301837 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57254922 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 154 (V154A)

Ref Sequence

ENSEMBL: ENSMUSP00000122490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075637] [ENSMUST00000153926]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075637
AA Change: V154A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: V154A

Domain	Start	End	E-Value	Type
B41	25	222	2.44e-67	SMART
FERM_C	226	316	2.64e-25	SMART
low complexity region	454	470	N/A	INTRINSIC
PDZ	519	598	1.65e-15	SMART
PTPc	645	903	5.66e-117	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150445

Predicted Effect

probably damaging
Transcript: ENSMUST00000153926
AA Change: V154A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122490
Gene: ENSMUSG00000038764
AA Change: V154A

Domain	Start	End	E-Value	Type
B41	25	222	2.44e-67	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034E13Rik	A	G	18: 52,660,506	N37S	probably damaging	Het
9530053A07Rik	G	T	7: 28,157,854	C2209F	probably damaging	Het
Acad10	T	C	5: 121,647,836	K230R	probably damaging	Het
Actl7a	A	G	4: 56,744,252	N260D	probably benign	Het
Adam24	T	C	8: 40,679,603	Y37H	probably benign	Het
Ahcy	G	A	2: 155,064,234	A229V	probably benign	Het
Ap3b2	A	G	7: 81,467,599	V563A	possibly damaging	Het
Bcl9l	T	A	9: 44,509,689	M1427K	probably damaging	Het
Btf3	C	T	13: 98,316,296	M1I	probably null	Het
Btg4	A	T	9: 51,116,610	I27L	probably benign	Het
Ccdc171	A	G	4: 83,620,839	Y366C	probably damaging	Het
Chd3	A	G	11: 69,355,654	Y1085H	probably damaging	Het
Cnot10	T	C	9: 114,597,824	D616G	possibly damaging	Het
Crlf1	C	A	8: 70,500,906	D243E	probably damaging	Het
Cyp2b23	A	G	7: 26,673,077	V371A	possibly damaging	Het
Dennd2a	A	G	6: 39,493,157	S534P	probably damaging	Het
Eln	A	G	5: 134,729,184	V185A	unknown	Het
Epor	C	T	9: 21,959,771	G301D	probably damaging	Het
Fam83f	T	G	15: 80,692,267	V373G	possibly damaging	Het
Fbxl21	A	T	13: 56,537,102	T340S	probably benign	Het
Fez1	T	A	9: 36,843,733	D9E	probably damaging	Het
Fsip2	T	C	2: 82,989,912	F5330L	probably benign	Het
Glis1	G	A	4: 107,568,347	R197Q	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gpr158	A	G	2: 21,827,548	N1153S	probably benign	Het
Gramd4	T	C	15: 86,091,529		probably null	Het
Hhatl	T	A	9: 121,789,059	Y210F	possibly damaging	Het
Hltf	T	C	3: 20,086,188	W422R	probably damaging	Het
Hspa5	T	C	2: 34,772,692	S87P	possibly damaging	Het
Il21	T	C	3: 37,227,662	H111R	probably benign	Het
Ip6k1	G	A	9: 108,040,984	G73S	probably benign	Het
Kdm5b	A	G	1: 134,618,017	D972G	possibly damaging	Het
Kif21b	C	T	1: 136,156,142	A709V	probably damaging	Het
Kmt2d	T	C	15: 98,845,234		probably benign	Het
Lrrc14b	A	G	13: 74,363,586	L125P	probably damaging	Het
Mapk8ip3	A	G	17: 24,899,854	S1169P	probably damaging	Het
Me3	A	T	7: 89,851,833	Y584F	probably damaging	Het
Mxra7	T	G	11: 116,816,244		probably null	Het
Nf1	T	C	11: 79,443,931	S870P	probably benign	Het
Npr2	G	A	4: 43,643,350	G525S	probably damaging	Het
Nyap1	A	T	5: 137,733,125	S726T	probably damaging	Het
Padi4	A	G	4: 140,746,170	V652A	probably damaging	Het
Pclo	A	G	5: 14,676,510		probably benign	Het
Pgm2	G	A	4: 99,964,865		probably null	Het
Piezo2	A	G	18: 63,021,173	S2512P	probably damaging	Het
Ptbp3	A	T	4: 59,482,624	D386E	probably damaging	Het
Ptk2	A	G	15: 73,242,406	V701A	possibly damaging	Het
Rassf4	T	C	6: 116,639,489	E287G	probably damaging	Het
Rnh1	C	T	7: 141,164,023	R174H	probably benign	Het
Scn9a	T	A	2: 66,487,594	I1517F	probably damaging	Het
Sftpb	C	A	6: 72,305,813	A90E	probably benign	Het
Slc39a14	T	C	14: 70,318,744	K61R	probably damaging	Het
Tmem132d	A	C	5: 127,784,858	M733R	probably benign	Het
Tmem248	A	G	5: 130,236,823	I156V	probably benign	Het
Traf2	T	C	2: 25,524,483	D339G	probably damaging	Het
Trappc11	A	G	8: 47,529,327		probably null	Het
Tuba8	T	A	6: 121,222,768	I137N	possibly damaging	Het
Txlnb	A	G	10: 17,838,947	T376A	probably damaging	Het
Usp34	A	G	11: 23,364,103	T663A	probably benign	Het
Vmn2r26	T	A	6: 124,061,472	F669I	probably damaging	Het
Wdr95	G	A	5: 149,595,396		probably null	Het
Wfdc8	T	G	2: 164,608,869		probably benign	Het
Zfp64	A	C	2: 168,926,318	V458G	probably benign	Het
Zfp868	C	T	8: 69,611,868	G272D	probably damaging	Het

Other mutations in Ptpn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:Ptpn3	APN	4	57270050	missense	possibly damaging	0.95
IGL01090:Ptpn3	APN	4	57240833	missense	probably damaging	1.00
IGL01399:Ptpn3	APN	4	57225775	missense	probably benign	0.01
IGL01413:Ptpn3	APN	4	57270156	missense	probably damaging	0.96
IGL01418:Ptpn3	APN	4	57270156	missense	probably damaging	0.96
IGL01806:Ptpn3	APN	4	57254915	critical splice donor site	probably null
IGL01933:Ptpn3	APN	4	57197576	missense	probably benign	0.00
IGL02087:Ptpn3	APN	4	57222019	missense	probably damaging	1.00
IGL02269:Ptpn3	APN	4	57197510	missense	possibly damaging	0.72
IGL02413:Ptpn3	APN	4	57205020	missense	probably damaging	1.00
IGL03163:Ptpn3	APN	4	57222020	missense	probably damaging	1.00
R0179:Ptpn3	UTSW	4	57270118	missense	probably benign	0.00
R0240:Ptpn3	UTSW	4	57232374	missense	probably benign
R0240:Ptpn3	UTSW	4	57232374	missense	probably benign
R0310:Ptpn3	UTSW	4	57204958	missense	probably benign	0.00
R0492:Ptpn3	UTSW	4	57194304	missense	probably benign
R0631:Ptpn3	UTSW	4	57204921	missense	probably damaging	0.99
R0656:Ptpn3	UTSW	4	57270075	missense	probably benign	0.41
R1443:Ptpn3	UTSW	4	57225775	missense	probably benign	0.01
R1856:Ptpn3	UTSW	4	57239682	missense	probably damaging	1.00
R3753:Ptpn3	UTSW	4	57270144	missense	probably damaging	1.00
R4431:Ptpn3	UTSW	4	57235355	missense	probably damaging	0.97
R4704:Ptpn3	UTSW	4	57270119	missense	possibly damaging	0.79
R4935:Ptpn3	UTSW	4	57197568	missense	probably damaging	1.00
R5119:Ptpn3	UTSW	4	57218513	missense	possibly damaging	0.93
R5410:Ptpn3	UTSW	4	57205019	missense	probably damaging	1.00
R5554:Ptpn3	UTSW	4	57240843	missense	probably damaging	0.99
R6024:Ptpn3	UTSW	4	57248653	splice site	probably null
R6061:Ptpn3	UTSW	4	57248681	missense	probably damaging	1.00
R6212:Ptpn3	UTSW	4	57270070	missense	probably damaging	1.00
R6213:Ptpn3	UTSW	4	57265012	missense	probably damaging	1.00
R6239:Ptpn3	UTSW	4	57249981	missense	probably benign
R6444:Ptpn3	UTSW	4	57195730	missense	possibly damaging	0.51
R6606:Ptpn3	UTSW	4	57265104	splice site	probably null
R6656:Ptpn3	UTSW	4	57205905	missense	probably damaging	0.99
R6730:Ptpn3	UTSW	4	57270088	missense	probably benign
R7133:Ptpn3	UTSW	4	57225863	missense	probably benign	0.30
R7231:Ptpn3	UTSW	4	57245062	missense	probably damaging	1.00
R7237:Ptpn3	UTSW	4	57239625	missense	probably damaging	1.00
R7368:Ptpn3	UTSW	4	57221993	missense	probably damaging	1.00
R7604:Ptpn3	UTSW	4	57240845	missense	probably damaging	0.99
R7742:Ptpn3	UTSW	4	57265092	critical splice acceptor site	probably null
R8023:Ptpn3	UTSW	4	57248688	missense	probably benign	0.02
R8099:Ptpn3	UTSW	4	57204985	nonsense	probably null
R8155:Ptpn3	UTSW	4	57232336	missense	probably benign
R8302:Ptpn3	UTSW	4	57218514	missense	probably benign	0.01
R8315:Ptpn3	UTSW	4	57270063	missense	possibly damaging	0.88
R8335:Ptpn3	UTSW	4	57235286	missense	probably damaging	0.99
R8346:Ptpn3	UTSW	4	57225547	missense	probably damaging	0.99
R8348:Ptpn3	UTSW	4	57240784	critical splice donor site	probably null
R8448:Ptpn3	UTSW	4	57240784	critical splice donor site	probably null
R8513:Ptpn3	UTSW	4	57270085	nonsense	probably null
R8846:Ptpn3	UTSW	4	57205020	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGCCTTCCAGCAAATTCCTTAACC -3'
(R):5'- CGGAGTTGCCTTGAAGATTCAATCACG -3'

Sequencing Primer
(F):5'- GCTCTGGAAAAAAGCTGGTTGTATC -3'
(R):5'- CCTTGAAGATTCAATCACGTTGTTG -3'

Posted On

2014-05-23