Incidental Mutation 'R1741:Ptbp3'
ID 200332
Institutional Source Beutler Lab
Gene Symbol Ptbp3
Ensembl Gene ENSMUSG00000028382
Gene Name polypyrimidine tract binding protein 3
Synonyms Rod1, 5830471K22Rik
MMRRC Submission 039773-MU
Accession Numbers

Genbank: NM_144904; MGI: 1923334; Ensembl: ENSMUST00000030076

Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 59471868-59549364 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59482624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 386 (D386E)
Ref Sequence ENSEMBL: ENSMUSP00000133612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030076] [ENSMUST00000102883] [ENSMUST00000148331] [ENSMUST00000172471] [ENSMUST00000172768] [ENSMUST00000173699] [ENSMUST00000174586] [ENSMUST00000174748]
AlphaFold Q8BHD7
Predicted Effect possibly damaging
Transcript: ENSMUST00000030076
AA Change: D355E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030076
Gene: ENSMUSG00000028382
AA Change: D355E

DomainStartEndE-ValueType
RRM 31 100 2.24e-3 SMART
low complexity region 115 130 N/A INTRINSIC
RRM 154 223 2.51e-6 SMART
low complexity region 277 293 N/A INTRINSIC
RRM 330 399 2.13e-9 SMART
RRM 447 517 1.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102883
AA Change: D383E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099947
Gene: ENSMUSG00000028382
AA Change: D383E

DomainStartEndE-ValueType
RRM 59 128 2.24e-3 SMART
low complexity region 143 158 N/A INTRINSIC
RRM 182 251 2.51e-6 SMART
low complexity region 305 321 N/A INTRINSIC
RRM 358 427 2.13e-9 SMART
RRM 475 545 1.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148331
AA Change: D352E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122840
Gene: ENSMUSG00000028382
AA Change: D352E

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172471
AA Change: D117E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133886
Gene: ENSMUSG00000028382
AA Change: D117E

DomainStartEndE-ValueType
PDB:1SJR|A 1 34 2e-11 PDB
Blast:RRM_2 1 37 6e-9 BLAST
low complexity region 44 64 N/A INTRINSIC
RRM 92 161 2.13e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172768
AA Change: D352E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134102
Gene: ENSMUSG00000028382
AA Change: D352E

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173268
Predicted Effect probably damaging
Transcript: ENSMUST00000173699
AA Change: D289E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134290
Gene: ENSMUSG00000028382
AA Change: D289E

DomainStartEndE-ValueType
PDB:2CQ1|A 2 44 7e-18 PDB
low complexity region 49 64 N/A INTRINSIC
RRM 88 157 2.51e-6 SMART
low complexity region 211 227 N/A INTRINSIC
RRM 264 333 2.13e-9 SMART
RRM 381 451 1.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174586
AA Change: D386E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133612
Gene: ENSMUSG00000028382
AA Change: D386E

DomainStartEndE-ValueType
RRM 62 131 2.24e-3 SMART
low complexity region 146 161 N/A INTRINSIC
RRM 185 254 2.51e-6 SMART
low complexity region 308 324 N/A INTRINSIC
RRM 361 430 2.13e-9 SMART
RRM 478 548 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174748
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds RNA and is a regulator of cell differentiation. The encoded protein preferentially binds to poly(G) and poly(U) sequences in vitro. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Ptbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Ptbp3 APN 4 59477228 missense probably benign 0.29
IGL03035:Ptbp3 APN 4 59477218 missense probably benign 0.00
IGL03118:Ptbp3 APN 4 59501470 missense probably benign 0.03
IGL03257:Ptbp3 APN 4 59493370 splice site probably benign
IGL03279:Ptbp3 APN 4 59476937 missense possibly damaging 0.68
R0557:Ptbp3 UTSW 4 59517684 nonsense probably null
R1914:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R1915:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R2679:Ptbp3 UTSW 4 59494615 splice site probably benign
R3798:Ptbp3 UTSW 4 59546166 missense probably benign 0.05
R4793:Ptbp3 UTSW 4 59514297 missense possibly damaging 0.71
R4869:Ptbp3 UTSW 4 59524443 missense possibly damaging 0.79
R5573:Ptbp3 UTSW 4 59485626 missense probably damaging 1.00
R5986:Ptbp3 UTSW 4 59493311 missense probably benign 0.37
R6350:Ptbp3 UTSW 4 59482624 missense probably damaging 0.98
R6659:Ptbp3 UTSW 4 59517640 missense probably damaging 1.00
R7283:Ptbp3 UTSW 4 59514384 missense probably benign 0.00
R7523:Ptbp3 UTSW 4 59546159 missense probably benign
R7566:Ptbp3 UTSW 4 59514280 missense probably benign 0.03
R8807:Ptbp3 UTSW 4 59517584 missense probably benign
YA93:Ptbp3 UTSW 4 59524413 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCTGCTGCAAAACTACATCCGTACC -3'
(R):5'- TCTTTAGCCAGGGATACCCAACACC -3'

Sequencing Primer
(F):5'- TCCGTACCAGTTCTACAACG -3'
(R):5'- ATGTGACAGGGATTGAATCCATTG -3'
Posted On 2014-05-23