Incidental Mutation 'R1741:Nyap1'
ID 200342
Institutional Source Beutler Lab
Gene Symbol Nyap1
Ensembl Gene ENSMUSG00000045348
Gene Name neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms 6430598A04Rik, Nyap1
MMRRC Submission 039773-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 137729144-137739430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 137731387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 726 (S726T)
Ref Sequence ENSEMBL: ENSMUSP00000114694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061789] [ENSMUST00000118326] [ENSMUST00000149512] [ENSMUST00000212152]
AlphaFold Q6PFX7
Predicted Effect probably damaging
Transcript: ENSMUST00000061789
AA Change: S726T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058217
Gene: ENSMUSG00000045348
AA Change: S726T

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118326
AA Change: S726T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113397
Gene: ENSMUSG00000045348
AA Change: S726T

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119498
AA Change: S726T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112894
Gene: ENSMUSG00000045348
AA Change: S726T

DomainStartEndE-ValueType
Pfam:NYAP_N 1 410 1.2e-104 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 571 833 4e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149512
AA Change: S726T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114694
Gene: ENSMUSG00000045348
AA Change: S726T

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 7.1e-128 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 771 1.9e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212152
AA Change: S725T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,793,578 (GRCm39) N37S probably damaging Het
Acad10 T C 5: 121,785,899 (GRCm39) K230R probably damaging Het
Actl7a A G 4: 56,744,252 (GRCm39) N260D probably benign Het
Adam24 T C 8: 41,132,642 (GRCm39) Y37H probably benign Het
Ahcy G A 2: 154,906,154 (GRCm39) A229V probably benign Het
Ap3b2 A G 7: 81,117,347 (GRCm39) V563A possibly damaging Het
Bcl9l T A 9: 44,420,986 (GRCm39) M1427K probably damaging Het
Btf3 C T 13: 98,452,804 (GRCm39) M1I probably null Het
Btg4 A T 9: 51,027,910 (GRCm39) I27L probably benign Het
Ccdc171 A G 4: 83,539,076 (GRCm39) Y366C probably damaging Het
Chd3 A G 11: 69,246,480 (GRCm39) Y1085H probably damaging Het
Cnot10 T C 9: 114,426,892 (GRCm39) D616G possibly damaging Het
Crlf1 C A 8: 70,953,556 (GRCm39) D243E probably damaging Het
Cyp2b23 A G 7: 26,372,502 (GRCm39) V371A possibly damaging Het
Dennd2a A G 6: 39,470,091 (GRCm39) S534P probably damaging Het
Eln A G 5: 134,758,038 (GRCm39) V185A unknown Het
Epor C T 9: 21,871,067 (GRCm39) G301D probably damaging Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Fbxl21 A T 13: 56,684,915 (GRCm39) T340S probably benign Het
Fcgbpl1 G T 7: 27,857,279 (GRCm39) C2209F probably damaging Het
Fez1 T A 9: 36,755,029 (GRCm39) D9E probably damaging Het
Fsip2 T C 2: 82,820,256 (GRCm39) F5330L probably benign Het
Glis1 G A 4: 107,425,544 (GRCm39) R197Q probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gpr158 A G 2: 21,832,359 (GRCm39) N1153S probably benign Het
Gramd4 T C 15: 85,975,730 (GRCm39) probably null Het
Hhatl T A 9: 121,618,125 (GRCm39) Y210F possibly damaging Het
Hltf T C 3: 20,140,352 (GRCm39) W422R probably damaging Het
Hspa5 T C 2: 34,662,704 (GRCm39) S87P possibly damaging Het
Il21 T C 3: 37,281,811 (GRCm39) H111R probably benign Het
Ip6k1 G A 9: 107,918,183 (GRCm39) G73S probably benign Het
Kdm5b A G 1: 134,545,755 (GRCm39) D972G possibly damaging Het
Kif21b C T 1: 136,083,880 (GRCm39) A709V probably damaging Het
Kmt2d T C 15: 98,743,115 (GRCm39) probably benign Het
Lrrc14b A G 13: 74,511,705 (GRCm39) L125P probably damaging Het
Mapk8ip3 A G 17: 25,118,828 (GRCm39) S1169P probably damaging Het
Me3 A T 7: 89,501,041 (GRCm39) Y584F probably damaging Het
Mxra7 T G 11: 116,707,070 (GRCm39) probably null Het
Nf1 T C 11: 79,334,757 (GRCm39) S870P probably benign Het
Npr2 G A 4: 43,643,350 (GRCm39) G525S probably damaging Het
Padi4 A G 4: 140,473,481 (GRCm39) V652A probably damaging Het
Pclo A G 5: 14,726,524 (GRCm39) probably benign Het
Pgm1 G A 4: 99,822,062 (GRCm39) probably null Het
Piezo2 A G 18: 63,154,244 (GRCm39) S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 (GRCm39) D386E probably damaging Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 (GRCm39) V154A probably damaging Het
Rassf4 T C 6: 116,616,450 (GRCm39) E287G probably damaging Het
Rnh1 C T 7: 140,743,936 (GRCm39) R174H probably benign Het
Scn9a T A 2: 66,317,938 (GRCm39) I1517F probably damaging Het
Sftpb C A 6: 72,282,797 (GRCm39) A90E probably benign Het
Slc39a14 T C 14: 70,556,193 (GRCm39) K61R probably damaging Het
Tmem132d A C 5: 127,861,922 (GRCm39) M733R probably benign Het
Tmem248 A G 5: 130,265,664 (GRCm39) I156V probably benign Het
Traf2 T C 2: 25,414,495 (GRCm39) D339G probably damaging Het
Trappc11 A G 8: 47,982,362 (GRCm39) probably null Het
Tuba8 T A 6: 121,199,727 (GRCm39) I137N possibly damaging Het
Txlnb A G 10: 17,714,695 (GRCm39) T376A probably damaging Het
Usp34 A G 11: 23,314,103 (GRCm39) T663A probably benign Het
Vmn2r26 T A 6: 124,038,431 (GRCm39) F669I probably damaging Het
Wdr95 G A 5: 149,518,861 (GRCm39) probably null Het
Wfdc8 T G 2: 164,450,789 (GRCm39) probably benign Het
Zfp64 A C 2: 168,768,238 (GRCm39) V458G probably benign Het
Zfp868 C T 8: 70,064,519 (GRCm39) G272D probably damaging Het
Other mutations in Nyap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Nyap1 APN 5 137,736,346 (GRCm39) missense probably damaging 1.00
IGL02211:Nyap1 APN 5 137,737,937 (GRCm39) missense probably damaging 0.99
IGL02658:Nyap1 APN 5 137,733,746 (GRCm39) missense probably damaging 0.99
IGL03493:Nyap1 APN 5 137,733,278 (GRCm39) missense probably damaging 1.00
R0180:Nyap1 UTSW 5 137,736,283 (GRCm39) missense probably damaging 1.00
R0731:Nyap1 UTSW 5 137,733,560 (GRCm39) missense probably damaging 1.00
R1215:Nyap1 UTSW 5 137,733,395 (GRCm39) nonsense probably null
R1953:Nyap1 UTSW 5 137,733,294 (GRCm39) missense probably benign 0.01
R2006:Nyap1 UTSW 5 137,733,953 (GRCm39) missense possibly damaging 0.81
R2131:Nyap1 UTSW 5 137,731,943 (GRCm39) intron probably null
R2244:Nyap1 UTSW 5 137,733,576 (GRCm39) missense probably damaging 1.00
R4581:Nyap1 UTSW 5 137,734,284 (GRCm39) missense probably damaging 1.00
R4857:Nyap1 UTSW 5 137,733,840 (GRCm39) missense probably damaging 0.98
R5151:Nyap1 UTSW 5 137,734,376 (GRCm39) missense probably damaging 0.99
R5533:Nyap1 UTSW 5 137,733,726 (GRCm39) missense probably benign 0.15
R5695:Nyap1 UTSW 5 137,733,246 (GRCm39) missense probably damaging 1.00
R7201:Nyap1 UTSW 5 137,734,524 (GRCm39) missense probably damaging 1.00
R7210:Nyap1 UTSW 5 137,736,244 (GRCm39) missense probably damaging 1.00
R7374:Nyap1 UTSW 5 137,733,791 (GRCm39) missense probably damaging 1.00
R7434:Nyap1 UTSW 5 137,734,530 (GRCm39) missense probably damaging 1.00
R7658:Nyap1 UTSW 5 137,731,236 (GRCm39) missense probably benign
R7870:Nyap1 UTSW 5 137,733,658 (GRCm39) nonsense probably null
R7913:Nyap1 UTSW 5 137,733,231 (GRCm39) missense probably damaging 1.00
R8278:Nyap1 UTSW 5 137,730,077 (GRCm39) missense probably damaging 1.00
R8422:Nyap1 UTSW 5 137,734,083 (GRCm39) missense probably benign 0.01
R9145:Nyap1 UTSW 5 137,736,175 (GRCm39) missense probably benign
R9367:Nyap1 UTSW 5 137,734,248 (GRCm39) missense probably damaging 1.00
R9441:Nyap1 UTSW 5 137,733,194 (GRCm39) missense probably benign 0.02
R9568:Nyap1 UTSW 5 137,733,394 (GRCm39) nonsense probably null
R9680:Nyap1 UTSW 5 137,733,840 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACATGAGTGAGTGTGTCTGTCCTTTC -3'
(R):5'- ATCAGGAATCTGCCAGGGTCCATC -3'

Sequencing Primer
(F):5'- GTCTGTCCTTTCTTCTCATATCCAAG -3'
(R):5'- gctacactcctgcccctc -3'
Posted On 2014-05-23