Incidental Mutation 'R1741:Nyap1'
ID200342
Institutional Source Beutler Lab
Gene Symbol Nyap1
Ensembl Gene ENSMUSG00000045348
Gene Nameneuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms6430598A04Rik, Nyap1
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137729899-137741607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137733125 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 726 (S726T)
Ref Sequence ENSEMBL: ENSMUSP00000114694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061789] [ENSMUST00000118326] [ENSMUST00000149512] [ENSMUST00000212152]
Predicted Effect probably damaging
Transcript: ENSMUST00000061789
AA Change: S726T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058217
Gene: ENSMUSG00000045348
AA Change: S726T

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118326
AA Change: S726T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113397
Gene: ENSMUSG00000045348
AA Change: S726T

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119498
AA Change: S726T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112894
Gene: ENSMUSG00000045348
AA Change: S726T

DomainStartEndE-ValueType
Pfam:NYAP_N 1 410 1.2e-104 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 571 833 4e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149512
AA Change: S726T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114694
Gene: ENSMUSG00000045348
AA Change: S726T

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 7.1e-128 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 771 1.9e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212152
AA Change: S725T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Nyap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Nyap1 APN 5 137738084 missense probably damaging 1.00
IGL02211:Nyap1 APN 5 137739675 missense probably damaging 0.99
IGL02658:Nyap1 APN 5 137735484 missense probably damaging 0.99
IGL03493:Nyap1 APN 5 137735016 missense probably damaging 1.00
R0180:Nyap1 UTSW 5 137738021 missense probably damaging 1.00
R0731:Nyap1 UTSW 5 137735298 missense probably damaging 1.00
R1215:Nyap1 UTSW 5 137735133 nonsense probably null
R1953:Nyap1 UTSW 5 137735032 missense probably benign 0.01
R2006:Nyap1 UTSW 5 137735691 missense possibly damaging 0.81
R2131:Nyap1 UTSW 5 137733681 intron probably null
R2244:Nyap1 UTSW 5 137735314 missense probably damaging 1.00
R4581:Nyap1 UTSW 5 137736022 missense probably damaging 1.00
R4857:Nyap1 UTSW 5 137735578 missense probably damaging 0.98
R5151:Nyap1 UTSW 5 137736114 missense probably damaging 0.99
R5533:Nyap1 UTSW 5 137735464 missense probably benign 0.15
R5695:Nyap1 UTSW 5 137734984 missense probably damaging 1.00
R7201:Nyap1 UTSW 5 137736262 missense probably damaging 1.00
R7210:Nyap1 UTSW 5 137737982 missense probably damaging 1.00
R7374:Nyap1 UTSW 5 137735529 missense probably damaging 1.00
R7434:Nyap1 UTSW 5 137736268 missense probably damaging 1.00
R7658:Nyap1 UTSW 5 137732974 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACATGAGTGAGTGTGTCTGTCCTTTC -3'
(R):5'- ATCAGGAATCTGCCAGGGTCCATC -3'

Sequencing Primer
(F):5'- GTCTGTCCTTTCTTCTCATATCCAAG -3'
(R):5'- gctacactcctgcccctc -3'
Posted On2014-05-23