Incidental Mutation 'R1741:Wdr95'
ID 200344
Institutional Source Beutler Lab
Gene Symbol Wdr95
Ensembl Gene ENSMUSG00000029658
Gene Name WD40 repeat domain 95
Synonyms 4930434E21Rik
MMRRC Submission 039773-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 149452144-149535359 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 149518861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110502] [ENSMUST00000110502] [ENSMUST00000201525] [ENSMUST00000202902] [ENSMUST00000202902]
AlphaFold D3Z7A8
Predicted Effect probably null
Transcript: ENSMUST00000110502
SMART Domains Protein: ENSMUSP00000106128
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
Pfam:WD40 4 28 3.3e-3 PFAM
WD40 32 71 4.38e-5 SMART
WD40 120 159 3.27e-4 SMART
WD40 162 203 1.71e-7 SMART
WD40 206 249 3.57e0 SMART
WD40 263 301 1.7e-2 SMART
Blast:WD40 315 363 3e-14 BLAST
Blast:WD40 367 408 4e-13 BLAST
WD40 421 460 2.01e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110502
SMART Domains Protein: ENSMUSP00000106128
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
Pfam:WD40 4 28 3.3e-3 PFAM
WD40 32 71 4.38e-5 SMART
WD40 120 159 3.27e-4 SMART
WD40 162 203 1.71e-7 SMART
WD40 206 249 3.57e0 SMART
WD40 263 301 1.7e-2 SMART
Blast:WD40 315 363 3e-14 BLAST
Blast:WD40 367 408 4e-13 BLAST
WD40 421 460 2.01e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121108
SMART Domains Protein: ENSMUSP00000113092
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125103
SMART Domains Protein: ENSMUSP00000120607
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
WD40 104 143 2e-6 SMART
WD40 146 187 1.1e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201525
SMART Domains Protein: ENSMUSP00000144234
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
WD40 104 143 2e-6 SMART
WD40 146 187 1.1e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202902
SMART Domains Protein: ENSMUSP00000144385
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202902
SMART Domains Protein: ENSMUSP00000144385
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,793,578 (GRCm39) N37S probably damaging Het
Acad10 T C 5: 121,785,899 (GRCm39) K230R probably damaging Het
Actl7a A G 4: 56,744,252 (GRCm39) N260D probably benign Het
Adam24 T C 8: 41,132,642 (GRCm39) Y37H probably benign Het
Ahcy G A 2: 154,906,154 (GRCm39) A229V probably benign Het
Ap3b2 A G 7: 81,117,347 (GRCm39) V563A possibly damaging Het
Bcl9l T A 9: 44,420,986 (GRCm39) M1427K probably damaging Het
Btf3 C T 13: 98,452,804 (GRCm39) M1I probably null Het
Btg4 A T 9: 51,027,910 (GRCm39) I27L probably benign Het
Ccdc171 A G 4: 83,539,076 (GRCm39) Y366C probably damaging Het
Chd3 A G 11: 69,246,480 (GRCm39) Y1085H probably damaging Het
Cnot10 T C 9: 114,426,892 (GRCm39) D616G possibly damaging Het
Crlf1 C A 8: 70,953,556 (GRCm39) D243E probably damaging Het
Cyp2b23 A G 7: 26,372,502 (GRCm39) V371A possibly damaging Het
Dennd2a A G 6: 39,470,091 (GRCm39) S534P probably damaging Het
Eln A G 5: 134,758,038 (GRCm39) V185A unknown Het
Epor C T 9: 21,871,067 (GRCm39) G301D probably damaging Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Fbxl21 A T 13: 56,684,915 (GRCm39) T340S probably benign Het
Fcgbpl1 G T 7: 27,857,279 (GRCm39) C2209F probably damaging Het
Fez1 T A 9: 36,755,029 (GRCm39) D9E probably damaging Het
Fsip2 T C 2: 82,820,256 (GRCm39) F5330L probably benign Het
Glis1 G A 4: 107,425,544 (GRCm39) R197Q probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gpr158 A G 2: 21,832,359 (GRCm39) N1153S probably benign Het
Gramd4 T C 15: 85,975,730 (GRCm39) probably null Het
Hhatl T A 9: 121,618,125 (GRCm39) Y210F possibly damaging Het
Hltf T C 3: 20,140,352 (GRCm39) W422R probably damaging Het
Hspa5 T C 2: 34,662,704 (GRCm39) S87P possibly damaging Het
Il21 T C 3: 37,281,811 (GRCm39) H111R probably benign Het
Ip6k1 G A 9: 107,918,183 (GRCm39) G73S probably benign Het
Kdm5b A G 1: 134,545,755 (GRCm39) D972G possibly damaging Het
Kif21b C T 1: 136,083,880 (GRCm39) A709V probably damaging Het
Kmt2d T C 15: 98,743,115 (GRCm39) probably benign Het
Lrrc14b A G 13: 74,511,705 (GRCm39) L125P probably damaging Het
Mapk8ip3 A G 17: 25,118,828 (GRCm39) S1169P probably damaging Het
Me3 A T 7: 89,501,041 (GRCm39) Y584F probably damaging Het
Mxra7 T G 11: 116,707,070 (GRCm39) probably null Het
Nf1 T C 11: 79,334,757 (GRCm39) S870P probably benign Het
Npr2 G A 4: 43,643,350 (GRCm39) G525S probably damaging Het
Nyap1 A T 5: 137,731,387 (GRCm39) S726T probably damaging Het
Padi4 A G 4: 140,473,481 (GRCm39) V652A probably damaging Het
Pclo A G 5: 14,726,524 (GRCm39) probably benign Het
Pgm1 G A 4: 99,822,062 (GRCm39) probably null Het
Piezo2 A G 18: 63,154,244 (GRCm39) S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 (GRCm39) D386E probably damaging Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 (GRCm39) V154A probably damaging Het
Rassf4 T C 6: 116,616,450 (GRCm39) E287G probably damaging Het
Rnh1 C T 7: 140,743,936 (GRCm39) R174H probably benign Het
Scn9a T A 2: 66,317,938 (GRCm39) I1517F probably damaging Het
Sftpb C A 6: 72,282,797 (GRCm39) A90E probably benign Het
Slc39a14 T C 14: 70,556,193 (GRCm39) K61R probably damaging Het
Tmem132d A C 5: 127,861,922 (GRCm39) M733R probably benign Het
Tmem248 A G 5: 130,265,664 (GRCm39) I156V probably benign Het
Traf2 T C 2: 25,414,495 (GRCm39) D339G probably damaging Het
Trappc11 A G 8: 47,982,362 (GRCm39) probably null Het
Tuba8 T A 6: 121,199,727 (GRCm39) I137N possibly damaging Het
Txlnb A G 10: 17,714,695 (GRCm39) T376A probably damaging Het
Usp34 A G 11: 23,314,103 (GRCm39) T663A probably benign Het
Vmn2r26 T A 6: 124,038,431 (GRCm39) F669I probably damaging Het
Wfdc8 T G 2: 164,450,789 (GRCm39) probably benign Het
Zfp64 A C 2: 168,768,238 (GRCm39) V458G probably benign Het
Zfp868 C T 8: 70,064,519 (GRCm39) G272D probably damaging Het
Other mutations in Wdr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Wdr95 APN 5 149,518,709 (GRCm39) critical splice acceptor site probably benign 0.00
IGL02352:Wdr95 APN 5 149,504,084 (GRCm39) missense probably damaging 0.99
IGL02359:Wdr95 APN 5 149,504,084 (GRCm39) missense probably damaging 0.99
IGL02478:Wdr95 APN 5 149,519,786 (GRCm39) missense probably benign 0.02
IGL03078:Wdr95 APN 5 149,535,062 (GRCm39) missense possibly damaging 0.63
IGL03201:Wdr95 APN 5 149,505,352 (GRCm39) splice site probably null
P0037:Wdr95 UTSW 5 149,511,536 (GRCm39) missense probably benign 0.27
R0115:Wdr95 UTSW 5 149,487,855 (GRCm39) missense probably damaging 1.00
R0538:Wdr95 UTSW 5 149,504,271 (GRCm39) missense probably damaging 1.00
R0606:Wdr95 UTSW 5 149,511,595 (GRCm39) missense probably damaging 1.00
R0723:Wdr95 UTSW 5 149,497,513 (GRCm39) missense probably damaging 1.00
R1104:Wdr95 UTSW 5 149,529,802 (GRCm39) missense probably benign 0.00
R1233:Wdr95 UTSW 5 149,518,829 (GRCm39) missense probably benign 0.00
R1233:Wdr95 UTSW 5 149,505,323 (GRCm39) missense possibly damaging 0.61
R1344:Wdr95 UTSW 5 149,511,563 (GRCm39) missense probably damaging 1.00
R1513:Wdr95 UTSW 5 149,522,759 (GRCm39) missense probably benign 0.00
R1623:Wdr95 UTSW 5 149,497,581 (GRCm39) missense probably damaging 1.00
R1633:Wdr95 UTSW 5 149,516,637 (GRCm39) missense probably damaging 0.98
R1664:Wdr95 UTSW 5 149,518,752 (GRCm39) missense probably damaging 0.98
R1686:Wdr95 UTSW 5 149,516,566 (GRCm39) missense probably damaging 1.00
R1750:Wdr95 UTSW 5 149,505,351 (GRCm39) splice site probably null
R1774:Wdr95 UTSW 5 149,487,857 (GRCm39) nonsense probably null
R1831:Wdr95 UTSW 5 149,475,891 (GRCm39) missense probably damaging 1.00
R1838:Wdr95 UTSW 5 149,522,831 (GRCm39) missense probably benign 0.00
R1907:Wdr95 UTSW 5 149,475,891 (GRCm39) missense probably damaging 1.00
R2019:Wdr95 UTSW 5 149,497,613 (GRCm39) splice site probably benign
R2063:Wdr95 UTSW 5 149,502,627 (GRCm39) splice site probably null
R2392:Wdr95 UTSW 5 149,504,135 (GRCm39) missense probably benign 0.03
R2863:Wdr95 UTSW 5 149,505,321 (GRCm39) nonsense probably null
R4116:Wdr95 UTSW 5 149,521,040 (GRCm39) missense probably benign 0.02
R4237:Wdr95 UTSW 5 149,486,802 (GRCm39) nonsense probably null
R4420:Wdr95 UTSW 5 149,456,131 (GRCm39) missense probably damaging 0.99
R4639:Wdr95 UTSW 5 149,505,279 (GRCm39) splice site probably benign
R4824:Wdr95 UTSW 5 149,518,797 (GRCm39) missense probably damaging 1.00
R4911:Wdr95 UTSW 5 149,535,157 (GRCm39) nonsense probably null
R5016:Wdr95 UTSW 5 149,468,266 (GRCm39) missense probably benign 0.00
R5458:Wdr95 UTSW 5 149,487,879 (GRCm39) missense probably damaging 1.00
R5486:Wdr95 UTSW 5 149,519,795 (GRCm39) nonsense probably null
R5613:Wdr95 UTSW 5 149,507,935 (GRCm39) missense probably damaging 1.00
R5906:Wdr95 UTSW 5 149,487,692 (GRCm39) missense possibly damaging 0.50
R5956:Wdr95 UTSW 5 149,517,947 (GRCm39) missense probably benign 0.00
R6309:Wdr95 UTSW 5 149,504,268 (GRCm39) critical splice acceptor site probably null
R6867:Wdr95 UTSW 5 149,504,388 (GRCm39) splice site probably null
R6964:Wdr95 UTSW 5 149,505,315 (GRCm39) missense probably damaging 1.00
R7008:Wdr95 UTSW 5 149,535,005 (GRCm39) missense probably benign 0.00
R7208:Wdr95 UTSW 5 149,518,836 (GRCm39) missense probably benign 0.02
R7309:Wdr95 UTSW 5 149,529,758 (GRCm39) missense probably benign 0.01
R7504:Wdr95 UTSW 5 149,505,311 (GRCm39) missense probably damaging 0.99
R7660:Wdr95 UTSW 5 149,517,945 (GRCm39) missense possibly damaging 0.86
R7997:Wdr95 UTSW 5 149,502,622 (GRCm39) critical splice donor site probably null
R8084:Wdr95 UTSW 5 149,511,598 (GRCm39) missense probably damaging 1.00
R8356:Wdr95 UTSW 5 149,502,572 (GRCm39) missense probably damaging 1.00
R8456:Wdr95 UTSW 5 149,502,572 (GRCm39) missense probably damaging 1.00
R8523:Wdr95 UTSW 5 149,497,461 (GRCm39) missense probably damaging 1.00
R8682:Wdr95 UTSW 5 149,518,752 (GRCm39) missense possibly damaging 0.94
R9451:Wdr95 UTSW 5 149,504,165 (GRCm39) missense probably benign 0.01
R9453:Wdr95 UTSW 5 149,475,917 (GRCm39) missense probably damaging 0.99
R9779:Wdr95 UTSW 5 149,505,293 (GRCm39) missense probably benign 0.01
X0024:Wdr95 UTSW 5 149,511,632 (GRCm39) missense possibly damaging 0.81
Z1176:Wdr95 UTSW 5 149,489,901 (GRCm39) missense probably benign 0.34
Z1177:Wdr95 UTSW 5 149,468,241 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCAGTCCAGAGAGAAAGCCCAG -3'
(R):5'- GCATTAGACACAAGTTGTCAATGTGCC -3'

Sequencing Primer
(F):5'- AGGTGAGCGGCATCGTG -3'
(R):5'- TGGTGCTAACAGATGCCC -3'
Posted On 2014-05-23