Incidental Mutation 'R1741:Sftpb'
ID 200346
Institutional Source Beutler Lab
Gene Symbol Sftpb
Ensembl Gene ENSMUSG00000056370
Gene Name surfactant associated protein B
Synonyms Sftp-3, SP-B, SF-B, Sftp3
MMRRC Submission 039773-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.632) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 72304610-72314371 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 72305813 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 90 (A90E)
Ref Sequence ENSEMBL: ENSMUSP00000138485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070437] [ENSMUST00000182014] [ENSMUST00000183018] [ENSMUST00000183278]
AlphaFold P50405
Predicted Effect probably benign
Transcript: ENSMUST00000070437
AA Change: A90E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000066805
Gene: ENSMUSG00000056370
AA Change: A90E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
SapB 197 267 7.13e-10 SMART
SapB 292 361 2.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182014
AA Change: A90E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138204
Gene: ENSMUSG00000056370
AA Change: A90E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182765
SMART Domains Protein: ENSMUSP00000138298
Gene: ENSMUSG00000056370

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
Blast:SapB 43 91 1e-20 BLAST
PDB:2JOU|A 45 92 1e-7 PDB
SapB 116 185 2.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183018
AA Change: A90E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138695
Gene: ENSMUSG00000056370
AA Change: A90E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
Blast:SapB 197 245 3e-19 BLAST
PDB:2JOU|A 199 246 3e-7 PDB
SapB 270 339 2.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183278
AA Change: A90E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138485
Gene: ENSMUSG00000056370
AA Change: A90E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
PHENOTYPE: Inactivation of this gene results in respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Sftpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Sftpb APN 6 72309862 missense probably benign 0.03
IGL02013:Sftpb APN 6 72305671 missense probably benign 0.08
R2159:Sftpb UTSW 6 72309786 missense probably damaging 1.00
R5108:Sftpb UTSW 6 72304656 missense probably damaging 1.00
R5315:Sftpb UTSW 6 72306892 missense probably benign 0.31
R5506:Sftpb UTSW 6 72304667 missense possibly damaging 0.46
R6415:Sftpb UTSW 6 72304649 missense probably damaging 0.96
R6622:Sftpb UTSW 6 72305655 missense possibly damaging 0.95
R7130:Sftpb UTSW 6 72305824 missense possibly damaging 0.89
R7342:Sftpb UTSW 6 72309875 missense probably benign 0.01
R7527:Sftpb UTSW 6 72305064 missense possibly damaging 0.69
R7644:Sftpb UTSW 6 72309835 missense probably benign 0.27
R9291:Sftpb UTSW 6 72309897 nonsense probably null
R9365:Sftpb UTSW 6 72307205 nonsense probably null
R9432:Sftpb UTSW 6 72306859 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTCAATCCCTGGAGTTAGGAG -3'
(R):5'- AAGTGCCCACTTAGGCACATGC -3'

Sequencing Primer
(F):5'- TTCCAGAATGACCTGTGCCAAG -3'
(R):5'- TCAATAACCAGGGGCAGGTA -3'
Posted On 2014-05-23