Incidental Mutation 'R1741:Adam24'
ID 200356
Institutional Source Beutler Lab
Gene Symbol Adam24
Ensembl Gene ENSMUSG00000046723
Gene Name ADAM metallopeptidase domain 24
Synonyms Dtgn5
MMRRC Submission 039773-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 41128118-41135238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41132642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 37 (Y37H)
Ref Sequence ENSEMBL: ENSMUSP00000050727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051614]
AlphaFold Q9R160
Predicted Effect probably benign
Transcript: ENSMUST00000051614
AA Change: Y37H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050727
Gene: ENSMUSG00000046723
AA Change: Y37H

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 160 3.3e-14 PFAM
Pfam:Reprolysin_2 193 389 6.3e-13 PFAM
Pfam:Reprolysin 208 398 7.8e-43 PFAM
Pfam:Reprolysin_5 209 382 3e-17 PFAM
Pfam:Reprolysin_4 209 392 4.9e-13 PFAM
Pfam:Reprolysin_3 232 353 9.9e-16 PFAM
DISIN 415 491 7.13e-39 SMART
ACR 492 628 7.74e-69 SMART
transmembrane domain 698 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210267
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Male mice lacking the encoded protein exhibit reduced fertility due to the higher incidence of polyspermic embryos. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile and produce an increased number of polyspermic embryos at the pronuclear stage. Female homozygotes show normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,793,578 (GRCm39) N37S probably damaging Het
Acad10 T C 5: 121,785,899 (GRCm39) K230R probably damaging Het
Actl7a A G 4: 56,744,252 (GRCm39) N260D probably benign Het
Ahcy G A 2: 154,906,154 (GRCm39) A229V probably benign Het
Ap3b2 A G 7: 81,117,347 (GRCm39) V563A possibly damaging Het
Bcl9l T A 9: 44,420,986 (GRCm39) M1427K probably damaging Het
Btf3 C T 13: 98,452,804 (GRCm39) M1I probably null Het
Btg4 A T 9: 51,027,910 (GRCm39) I27L probably benign Het
Ccdc171 A G 4: 83,539,076 (GRCm39) Y366C probably damaging Het
Chd3 A G 11: 69,246,480 (GRCm39) Y1085H probably damaging Het
Cnot10 T C 9: 114,426,892 (GRCm39) D616G possibly damaging Het
Crlf1 C A 8: 70,953,556 (GRCm39) D243E probably damaging Het
Cyp2b23 A G 7: 26,372,502 (GRCm39) V371A possibly damaging Het
Dennd2a A G 6: 39,470,091 (GRCm39) S534P probably damaging Het
Eln A G 5: 134,758,038 (GRCm39) V185A unknown Het
Epor C T 9: 21,871,067 (GRCm39) G301D probably damaging Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Fbxl21 A T 13: 56,684,915 (GRCm39) T340S probably benign Het
Fcgbpl1 G T 7: 27,857,279 (GRCm39) C2209F probably damaging Het
Fez1 T A 9: 36,755,029 (GRCm39) D9E probably damaging Het
Fsip2 T C 2: 82,820,256 (GRCm39) F5330L probably benign Het
Glis1 G A 4: 107,425,544 (GRCm39) R197Q probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gpr158 A G 2: 21,832,359 (GRCm39) N1153S probably benign Het
Gramd4 T C 15: 85,975,730 (GRCm39) probably null Het
Hhatl T A 9: 121,618,125 (GRCm39) Y210F possibly damaging Het
Hltf T C 3: 20,140,352 (GRCm39) W422R probably damaging Het
Hspa5 T C 2: 34,662,704 (GRCm39) S87P possibly damaging Het
Il21 T C 3: 37,281,811 (GRCm39) H111R probably benign Het
Ip6k1 G A 9: 107,918,183 (GRCm39) G73S probably benign Het
Kdm5b A G 1: 134,545,755 (GRCm39) D972G possibly damaging Het
Kif21b C T 1: 136,083,880 (GRCm39) A709V probably damaging Het
Kmt2d T C 15: 98,743,115 (GRCm39) probably benign Het
Lrrc14b A G 13: 74,511,705 (GRCm39) L125P probably damaging Het
Mapk8ip3 A G 17: 25,118,828 (GRCm39) S1169P probably damaging Het
Me3 A T 7: 89,501,041 (GRCm39) Y584F probably damaging Het
Mxra7 T G 11: 116,707,070 (GRCm39) probably null Het
Nf1 T C 11: 79,334,757 (GRCm39) S870P probably benign Het
Npr2 G A 4: 43,643,350 (GRCm39) G525S probably damaging Het
Nyap1 A T 5: 137,731,387 (GRCm39) S726T probably damaging Het
Padi4 A G 4: 140,473,481 (GRCm39) V652A probably damaging Het
Pclo A G 5: 14,726,524 (GRCm39) probably benign Het
Pgm1 G A 4: 99,822,062 (GRCm39) probably null Het
Piezo2 A G 18: 63,154,244 (GRCm39) S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 (GRCm39) D386E probably damaging Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 (GRCm39) V154A probably damaging Het
Rassf4 T C 6: 116,616,450 (GRCm39) E287G probably damaging Het
Rnh1 C T 7: 140,743,936 (GRCm39) R174H probably benign Het
Scn9a T A 2: 66,317,938 (GRCm39) I1517F probably damaging Het
Sftpb C A 6: 72,282,797 (GRCm39) A90E probably benign Het
Slc39a14 T C 14: 70,556,193 (GRCm39) K61R probably damaging Het
Tmem132d A C 5: 127,861,922 (GRCm39) M733R probably benign Het
Tmem248 A G 5: 130,265,664 (GRCm39) I156V probably benign Het
Traf2 T C 2: 25,414,495 (GRCm39) D339G probably damaging Het
Trappc11 A G 8: 47,982,362 (GRCm39) probably null Het
Tuba8 T A 6: 121,199,727 (GRCm39) I137N possibly damaging Het
Txlnb A G 10: 17,714,695 (GRCm39) T376A probably damaging Het
Usp34 A G 11: 23,314,103 (GRCm39) T663A probably benign Het
Vmn2r26 T A 6: 124,038,431 (GRCm39) F669I probably damaging Het
Wdr95 G A 5: 149,518,861 (GRCm39) probably null Het
Wfdc8 T G 2: 164,450,789 (GRCm39) probably benign Het
Zfp64 A C 2: 168,768,238 (GRCm39) V458G probably benign Het
Zfp868 C T 8: 70,064,519 (GRCm39) G272D probably damaging Het
Other mutations in Adam24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Adam24 APN 8 41,132,571 (GRCm39) missense probably benign 0.41
IGL02517:Adam24 APN 8 41,133,218 (GRCm39) missense probably damaging 1.00
R0195:Adam24 UTSW 8 41,134,805 (GRCm39) missense probably benign 0.00
R1067:Adam24 UTSW 8 41,133,793 (GRCm39) nonsense probably null
R1180:Adam24 UTSW 8 41,134,467 (GRCm39) missense probably damaging 1.00
R1438:Adam24 UTSW 8 41,134,431 (GRCm39) missense probably benign 0.19
R1779:Adam24 UTSW 8 41,134,004 (GRCm39) missense possibly damaging 0.83
R1940:Adam24 UTSW 8 41,134,400 (GRCm39) nonsense probably null
R2228:Adam24 UTSW 8 41,133,404 (GRCm39) missense probably benign 0.00
R2229:Adam24 UTSW 8 41,133,404 (GRCm39) missense probably benign 0.00
R2265:Adam24 UTSW 8 41,133,110 (GRCm39) missense possibly damaging 0.95
R2359:Adam24 UTSW 8 41,133,984 (GRCm39) missense possibly damaging 0.91
R3551:Adam24 UTSW 8 41,132,632 (GRCm39) missense probably benign 0.03
R3837:Adam24 UTSW 8 41,133,584 (GRCm39) missense probably benign
R4834:Adam24 UTSW 8 41,132,738 (GRCm39) missense probably damaging 1.00
R5121:Adam24 UTSW 8 41,132,550 (GRCm39) missense probably damaging 1.00
R5410:Adam24 UTSW 8 41,134,103 (GRCm39) missense probably benign 0.01
R5787:Adam24 UTSW 8 41,133,941 (GRCm39) missense possibly damaging 0.87
R5900:Adam24 UTSW 8 41,134,071 (GRCm39) missense probably benign 0.00
R6600:Adam24 UTSW 8 41,133,587 (GRCm39) missense probably damaging 1.00
R6633:Adam24 UTSW 8 41,133,526 (GRCm39) missense probably benign 0.12
R6672:Adam24 UTSW 8 41,134,572 (GRCm39) missense probably benign 0.01
R6904:Adam24 UTSW 8 41,134,542 (GRCm39) missense probably damaging 1.00
R7178:Adam24 UTSW 8 41,133,039 (GRCm39) nonsense probably null
R7542:Adam24 UTSW 8 41,133,848 (GRCm39) missense possibly damaging 0.46
R7578:Adam24 UTSW 8 41,133,294 (GRCm39) missense probably benign 0.01
R7708:Adam24 UTSW 8 41,133,558 (GRCm39) missense probably damaging 1.00
R8739:Adam24 UTSW 8 41,133,480 (GRCm39) missense possibly damaging 0.68
R8823:Adam24 UTSW 8 41,133,228 (GRCm39) missense probably benign 0.01
R9282:Adam24 UTSW 8 41,133,674 (GRCm39) missense probably damaging 1.00
R9434:Adam24 UTSW 8 41,133,284 (GRCm39) missense probably benign 0.04
R9508:Adam24 UTSW 8 41,132,941 (GRCm39) missense probably benign 0.28
R9591:Adam24 UTSW 8 41,132,698 (GRCm39) missense probably benign 0.00
X0010:Adam24 UTSW 8 41,133,054 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCAACAGGACCACATCCTATC -3'
(R):5'- TGAGACCACCATGACCCATAGATGC -3'

Sequencing Primer
(F):5'- AGGACCACATCCTATCCTCCTTC -3'
(R):5'- TGGACAAAAGGTCTGTCCTC -3'
Posted On 2014-05-23