Incidental Mutation 'R1741:Adam24'
ID200356
Institutional Source Beutler Lab
Gene Symbol Adam24
Ensembl Gene ENSMUSG00000046723
Gene Namea disintegrin and metallopeptidase domain 24 (testase 1)
SynonymsDtgn5
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40675077-40682199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40679603 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 37 (Y37H)
Ref Sequence ENSEMBL: ENSMUSP00000050727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051614]
Predicted Effect probably benign
Transcript: ENSMUST00000051614
AA Change: Y37H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050727
Gene: ENSMUSG00000046723
AA Change: Y37H

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 160 3.3e-14 PFAM
Pfam:Reprolysin_2 193 389 6.3e-13 PFAM
Pfam:Reprolysin 208 398 7.8e-43 PFAM
Pfam:Reprolysin_5 209 382 3e-17 PFAM
Pfam:Reprolysin_4 209 392 4.9e-13 PFAM
Pfam:Reprolysin_3 232 353 9.9e-16 PFAM
DISIN 415 491 7.13e-39 SMART
ACR 492 628 7.74e-69 SMART
transmembrane domain 698 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210267
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Male mice lacking the encoded protein exhibit reduced fertility due to the higher incidence of polyspermic embryos. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile and produce an increased number of polyspermic embryos at the pronuclear stage. Female homozygotes show normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Adam24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Adam24 APN 8 40679532 missense probably benign 0.41
IGL02517:Adam24 APN 8 40680179 missense probably damaging 1.00
R0195:Adam24 UTSW 8 40681766 missense probably benign 0.00
R1067:Adam24 UTSW 8 40680754 nonsense probably null
R1180:Adam24 UTSW 8 40681428 missense probably damaging 1.00
R1438:Adam24 UTSW 8 40681392 missense probably benign 0.19
R1779:Adam24 UTSW 8 40680965 missense possibly damaging 0.83
R1940:Adam24 UTSW 8 40681361 nonsense probably null
R2228:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2229:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2265:Adam24 UTSW 8 40680071 missense possibly damaging 0.95
R2359:Adam24 UTSW 8 40680945 missense possibly damaging 0.91
R3551:Adam24 UTSW 8 40679593 missense probably benign 0.03
R3837:Adam24 UTSW 8 40680545 missense probably benign
R4834:Adam24 UTSW 8 40679699 missense probably damaging 1.00
R5121:Adam24 UTSW 8 40679511 missense probably damaging 1.00
R5410:Adam24 UTSW 8 40681064 missense probably benign 0.01
R5787:Adam24 UTSW 8 40680902 missense possibly damaging 0.87
R5900:Adam24 UTSW 8 40681032 missense probably benign 0.00
R6600:Adam24 UTSW 8 40680548 missense probably damaging 1.00
R6633:Adam24 UTSW 8 40680487 missense probably benign 0.12
R6672:Adam24 UTSW 8 40681533 missense probably benign 0.01
R6904:Adam24 UTSW 8 40681503 missense probably damaging 1.00
R7178:Adam24 UTSW 8 40680000 nonsense probably null
R7542:Adam24 UTSW 8 40680809 missense possibly damaging 0.46
R7578:Adam24 UTSW 8 40680255 missense probably benign 0.01
X0010:Adam24 UTSW 8 40680015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCAACAGGACCACATCCTATC -3'
(R):5'- TGAGACCACCATGACCCATAGATGC -3'

Sequencing Primer
(F):5'- AGGACCACATCCTATCCTCCTTC -3'
(R):5'- TGGACAAAAGGTCTGTCCTC -3'
Posted On2014-05-23