Incidental Mutation 'R1741:Trappc11'
ID200357
Institutional Source Beutler Lab
Gene Symbol Trappc11
Ensembl Gene ENSMUSG00000038102
Gene Nametrafficking protein particle complex 11
SynonymsD030016E14Rik
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location47490115-47533470 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 47529327 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033973] [ENSMUST00000039061] [ENSMUST00000175692] [ENSMUST00000176379]
Predicted Effect probably benign
Transcript: ENSMUST00000033973
SMART Domains Protein: ENSMUSP00000033973
Gene: ENSMUSG00000031568

DomainStartEndE-ValueType
RWD 9 111 1.07e-12 SMART
low complexity region 131 153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000039061
SMART Domains Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102

DomainStartEndE-ValueType
Pfam:Foie-gras_1 263 522 3e-78 PFAM
Pfam:Gryzun 978 1114 3.9e-10 PFAM
Pfam:Gryzun-like 1036 1095 2.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131551
Predicted Effect probably benign
Transcript: ENSMUST00000175692
Predicted Effect probably benign
Transcript: ENSMUST00000176379
SMART Domains Protein: ENSMUSP00000135059
Gene: ENSMUSG00000031568

DomainStartEndE-ValueType
RWD 9 111 1.07e-12 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Trappc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Trappc11 APN 8 47503302 unclassified probably benign
IGL01300:Trappc11 APN 8 47501868 missense probably benign
IGL01312:Trappc11 APN 8 47505677 missense possibly damaging 0.95
IGL01344:Trappc11 APN 8 47519704 missense probably damaging 1.00
IGL01518:Trappc11 APN 8 47501869 splice site probably null
IGL01747:Trappc11 APN 8 47519621 missense probably benign 0.41
IGL01781:Trappc11 APN 8 47514128 missense possibly damaging 0.95
IGL01908:Trappc11 APN 8 47503994 missense probably damaging 1.00
IGL01956:Trappc11 APN 8 47528001 missense possibly damaging 0.86
IGL02266:Trappc11 APN 8 47505731 missense probably damaging 1.00
IGL02377:Trappc11 APN 8 47530650 critical splice donor site probably null
IGL02530:Trappc11 APN 8 47507582 missense probably damaging 1.00
IGL02676:Trappc11 APN 8 47493413 splice site probably benign
IGL03030:Trappc11 APN 8 47513929 missense probably damaging 0.98
IGL03393:Trappc11 APN 8 47510877 missense possibly damaging 0.95
bunyoro UTSW 8 47512285 splice site probably null
nyoro UTSW 8 47526979 missense possibly damaging 0.73
serval UTSW 8 47503965 missense probably damaging 1.00
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0043:Trappc11 UTSW 8 47505575 splice site probably benign
R0180:Trappc11 UTSW 8 47527974 missense possibly damaging 0.86
R0529:Trappc11 UTSW 8 47526979 missense possibly damaging 0.73
R0538:Trappc11 UTSW 8 47503412 missense probably benign 0.01
R0740:Trappc11 UTSW 8 47524588 missense probably damaging 0.99
R1352:Trappc11 UTSW 8 47525046 missense possibly damaging 0.90
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1502:Trappc11 UTSW 8 47530827 missense possibly damaging 0.94
R1589:Trappc11 UTSW 8 47501680 missense probably damaging 1.00
R2292:Trappc11 UTSW 8 47505736 missense probably damaging 1.00
R2303:Trappc11 UTSW 8 47503416 missense probably damaging 0.99
R2931:Trappc11 UTSW 8 47503942 missense probably damaging 0.99
R3522:Trappc11 UTSW 8 47498673 missense possibly damaging 0.93
R3714:Trappc11 UTSW 8 47505316 intron probably benign
R3739:Trappc11 UTSW 8 47514103 missense probably damaging 0.98
R4165:Trappc11 UTSW 8 47524968 splice site probably benign
R4581:Trappc11 UTSW 8 47493345 missense probably damaging 0.97
R4598:Trappc11 UTSW 8 47513766 missense probably damaging 0.98
R4939:Trappc11 UTSW 8 47519665 missense probably damaging 1.00
R4990:Trappc11 UTSW 8 47490895 missense probably benign 0.41
R4994:Trappc11 UTSW 8 47522441 nonsense probably null
R5091:Trappc11 UTSW 8 47512604 missense probably benign 0.00
R5123:Trappc11 UTSW 8 47513402 missense probably damaging 0.99
R5176:Trappc11 UTSW 8 47510963 missense possibly damaging 0.79
R5279:Trappc11 UTSW 8 47505304 intron probably benign
R5293:Trappc11 UTSW 8 47493342 missense possibly damaging 0.83
R5294:Trappc11 UTSW 8 47530731 missense possibly damaging 0.88
R5661:Trappc11 UTSW 8 47512607 missense probably damaging 0.99
R5838:Trappc11 UTSW 8 47512559 critical splice donor site probably null
R5889:Trappc11 UTSW 8 47519578 missense probably benign 0.40
R5952:Trappc11 UTSW 8 47496917 critical splice donor site probably null
R5959:Trappc11 UTSW 8 47501558 missense probably damaging 0.97
R6239:Trappc11 UTSW 8 47529494 missense possibly damaging 0.73
R6322:Trappc11 UTSW 8 47530773 missense possibly damaging 0.95
R6369:Trappc11 UTSW 8 47512285 splice site probably null
R7541:Trappc11 UTSW 8 47505582 splice site probably null
R7544:Trappc11 UTSW 8 47522414 missense possibly damaging 0.73
R7762:Trappc11 UTSW 8 47522376 missense probably damaging 0.99
R7964:Trappc11 UTSW 8 47526944 missense possibly damaging 0.54
R8183:Trappc11 UTSW 8 47529356 missense possibly damaging 0.93
R8282:Trappc11 UTSW 8 47516589 missense probably damaging 0.97
R8733:Trappc11 UTSW 8 47501848 missense probably damaging 1.00
R8782:Trappc11 UTSW 8 47498666 missense probably benign 0.44
R8853:Trappc11 UTSW 8 47529404 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCCAGGCCAACTAGCCTTCTAAATG -3'
(R):5'- TGACCAGCTAACTGTTTCTGTCACG -3'

Sequencing Primer
(F):5'- TTCAAAGGAGGTCAACAATCTCAG -3'
(R):5'- TGTCACGGTTGGCAGAGAAC -3'
Posted On2014-05-23