Incidental Mutation 'R1741:Btg4'
ID 200363
Institutional Source Beutler Lab
Gene Symbol Btg4
Ensembl Gene ENSMUSG00000032056
Gene Name B cell translocation gene 4
Synonyms PC3B
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 51060901-51119875 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51116610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 27 (I27L)
Ref Sequence ENSEMBL: ENSMUSP00000150174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114431] [ENSMUST00000213117] [ENSMUST00000213680] [ENSMUST00000214452]
AlphaFold O70552
Predicted Effect probably benign
Transcript: ENSMUST00000114431
AA Change: I27L

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110074
Gene: ENSMUSG00000032056
AA Change: I27L

DomainStartEndE-ValueType
btg1 1 108 7.37e-64 SMART
low complexity region 138 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213117
AA Change: I27L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213680
AA Change: I27L

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000214452
AA Change: I27L

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein can induce G1 arrest in the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Btg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02875:Btg4 APN 9 51119146 missense probably benign 0.17
R1876:Btg4 UTSW 9 51117189 missense probably damaging 1.00
R6794:Btg4 UTSW 9 51119351 missense possibly damaging 0.72
R7384:Btg4 UTSW 9 51119113 missense probably benign 0.13
R7606:Btg4 UTSW 9 51118007 missense probably damaging 1.00
R7877:Btg4 UTSW 9 51117940 missense probably benign 0.00
R8094:Btg4 UTSW 9 51119145 missense probably benign 0.04
R8231:Btg4 UTSW 9 51116568 missense possibly damaging 0.80
R9576:Btg4 UTSW 9 51119136 missense probably damaging 0.96
R9594:Btg4 UTSW 9 51119260 missense probably damaging 1.00
Z1176:Btg4 UTSW 9 51119175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTTTCCAACGGCGGTCCTC -3'
(R):5'- CAGATGCTACTGGTGACCCGATTC -3'

Sequencing Primer
(F):5'- AACGGCGGTCCTCTGAAG -3'
(R):5'- GGTGACCCGATTCCCCTC -3'
Posted On 2014-05-23