Incidental Mutation 'R1741:Ip6k1'
ID200364
Institutional Source Beutler Lab
Gene Symbol Ip6k1
Ensembl Gene ENSMUSG00000032594
Gene Nameinositol hexaphosphate kinase 1
Synonyms1200016D08Rik, InsP6, Ihpk1, InsP6k1
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108002501-108048782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108040984 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 73 (G73S)
Ref Sequence ENSEMBL: ENSMUSP00000134754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000164395] [ENSMUST00000175874] [ENSMUST00000176566] [ENSMUST00000177158]
Predicted Effect probably benign
Transcript: ENSMUST00000035214
AA Change: G172S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594
AA Change: G172S

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167159
Predicted Effect probably benign
Transcript: ENSMUST00000175874
SMART Domains Protein: ENSMUSP00000135747
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect probably benign
Transcript: ENSMUST00000176566
Predicted Effect probably benign
Transcript: ENSMUST00000176613
Predicted Effect probably benign
Transcript: ENSMUST00000177158
AA Change: G73S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134754
Gene: ENSMUSG00000032594
AA Change: G73S

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:IPK 108 206 1.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177396
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein may be responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired glucose tolerance, decreased insulin levels, bilateral epididymal aspermia, and testicular degeneration in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Ip6k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Ip6k1 APN 9 108045883 missense probably benign 0.01
R0147:Ip6k1 UTSW 9 108045894 missense probably damaging 1.00
R1371:Ip6k1 UTSW 9 108045823 missense probably damaging 0.96
R1530:Ip6k1 UTSW 9 108045562 nonsense probably null
R1716:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1717:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1718:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1719:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1745:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1747:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1901:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1902:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1903:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1962:Ip6k1 UTSW 9 108041088 critical splice donor site probably null
R2126:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R3809:Ip6k1 UTSW 9 108045887 missense probably damaging 1.00
R5000:Ip6k1 UTSW 9 108045599 nonsense probably null
R6074:Ip6k1 UTSW 9 108024109 utr 5 prime probably benign
R6921:Ip6k1 UTSW 9 108024435 missense probably damaging 1.00
R7069:Ip6k1 UTSW 9 108045452 splice site probably null
R7154:Ip6k1 UTSW 9 108045662 missense probably damaging 1.00
R7218:Ip6k1 UTSW 9 108045582 missense unknown
R7330:Ip6k1 UTSW 9 108045253 missense possibly damaging 0.56
R7731:Ip6k1 UTSW 9 108044728 missense probably damaging 1.00
R7736:Ip6k1 UTSW 9 108045692 missense probably damaging 1.00
R7765:Ip6k1 UTSW 9 108032089 missense possibly damaging 0.52
R7941:Ip6k1 UTSW 9 108024432 missense probably damaging 1.00
R8221:Ip6k1 UTSW 9 108045916 missense probably benign 0.40
R8383:Ip6k1 UTSW 9 108044727 missense possibly damaging 0.81
R8815:Ip6k1 UTSW 9 108041012 missense probably benign 0.38
X0021:Ip6k1 UTSW 9 108032190 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTACTTGGAGCCAGTGCCACC -3'
(R):5'- TTTTCCCCAGTGGAACCCATGC -3'

Sequencing Primer
(F):5'- CAGGTTCTGGGTGACAGAC -3'
(R):5'- AACCCATGCCCCTGTGAG -3'
Posted On2014-05-23