Mutagenetix > Incidental Mutation

Incidental Mutation 'R1741:Chd3'

200369

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

Chd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1

MMRRC Submission

039773-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1741 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69343273-69369406 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69355654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1085 (Y1085H)

Ref Sequence

ENSEMBL: ENSMUSP00000090649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]

AlphaFold

B1AR17

Predicted Effect

probably damaging
Transcript: ENSMUST00000092971
AA Change: Y1085H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: Y1085H

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108661
AA Change: Y1085H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: Y1085H

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000128981
AA Change: Y991H

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: Y991H

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144332

Predicted Effect

unknown
Transcript: ENSMUST00000151436
AA Change: Y139H

SMART Domains

Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474
AA Change: Y139H

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	142	9e-24	PFAM
SCOP:d1gkub2	162	197	1e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157256

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034E13Rik	A	G	18: 52,660,506	N37S	probably damaging	Het
9530053A07Rik	G	T	7: 28,157,854	C2209F	probably damaging	Het
Acad10	T	C	5: 121,647,836	K230R	probably damaging	Het
Actl7a	A	G	4: 56,744,252	N260D	probably benign	Het
Adam24	T	C	8: 40,679,603	Y37H	probably benign	Het
Ahcy	G	A	2: 155,064,234	A229V	probably benign	Het
Ap3b2	A	G	7: 81,467,599	V563A	possibly damaging	Het
Bcl9l	T	A	9: 44,509,689	M1427K	probably damaging	Het
Btf3	C	T	13: 98,316,296	M1I	probably null	Het
Btg4	A	T	9: 51,116,610	I27L	probably benign	Het
Ccdc171	A	G	4: 83,620,839	Y366C	probably damaging	Het
Cnot10	T	C	9: 114,597,824	D616G	possibly damaging	Het
Crlf1	C	A	8: 70,500,906	D243E	probably damaging	Het
Cyp2b23	A	G	7: 26,673,077	V371A	possibly damaging	Het
Dennd2a	A	G	6: 39,493,157	S534P	probably damaging	Het
Eln	A	G	5: 134,729,184	V185A	unknown	Het
Epor	C	T	9: 21,959,771	G301D	probably damaging	Het
Fam83f	T	G	15: 80,692,267	V373G	possibly damaging	Het
Fbxl21	A	T	13: 56,537,102	T340S	probably benign	Het
Fez1	T	A	9: 36,843,733	D9E	probably damaging	Het
Fsip2	T	C	2: 82,989,912	F5330L	probably benign	Het
Glis1	G	A	4: 107,568,347	R197Q	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gpr158	A	G	2: 21,827,548	N1153S	probably benign	Het
Gramd4	T	C	15: 86,091,529		probably null	Het
Hhatl	T	A	9: 121,789,059	Y210F	possibly damaging	Het
Hltf	T	C	3: 20,086,188	W422R	probably damaging	Het
Hspa5	T	C	2: 34,772,692	S87P	possibly damaging	Het
Il21	T	C	3: 37,227,662	H111R	probably benign	Het
Ip6k1	G	A	9: 108,040,984	G73S	probably benign	Het
Kdm5b	A	G	1: 134,618,017	D972G	possibly damaging	Het
Kif21b	C	T	1: 136,156,142	A709V	probably damaging	Het
Kmt2d	T	C	15: 98,845,234		probably benign	Het
Lrrc14b	A	G	13: 74,363,586	L125P	probably damaging	Het
Mapk8ip3	A	G	17: 24,899,854	S1169P	probably damaging	Het
Me3	A	T	7: 89,851,833	Y584F	probably damaging	Het
Mxra7	T	G	11: 116,816,244		probably null	Het
Nf1	T	C	11: 79,443,931	S870P	probably benign	Het
Npr2	G	A	4: 43,643,350	G525S	probably damaging	Het
Nyap1	A	T	5: 137,733,125	S726T	probably damaging	Het
Padi4	A	G	4: 140,746,170	V652A	probably damaging	Het
Pclo	A	G	5: 14,676,510		probably benign	Het
Pgm2	G	A	4: 99,964,865		probably null	Het
Piezo2	A	G	18: 63,021,173	S2512P	probably damaging	Het
Ptbp3	A	T	4: 59,482,624	D386E	probably damaging	Het
Ptk2	A	G	15: 73,242,406	V701A	possibly damaging	Het
Ptpn3	A	G	4: 57,254,922	V154A	probably damaging	Het
Rassf4	T	C	6: 116,639,489	E287G	probably damaging	Het
Rnh1	C	T	7: 141,164,023	R174H	probably benign	Het
Scn9a	T	A	2: 66,487,594	I1517F	probably damaging	Het
Sftpb	C	A	6: 72,305,813	A90E	probably benign	Het
Slc39a14	T	C	14: 70,318,744	K61R	probably damaging	Het
Tmem132d	A	C	5: 127,784,858	M733R	probably benign	Het
Tmem248	A	G	5: 130,236,823	I156V	probably benign	Het
Traf2	T	C	2: 25,524,483	D339G	probably damaging	Het
Trappc11	A	G	8: 47,529,327		probably null	Het
Tuba8	T	A	6: 121,222,768	I137N	possibly damaging	Het
Txlnb	A	G	10: 17,838,947	T376A	probably damaging	Het
Usp34	A	G	11: 23,364,103	T663A	probably benign	Het
Vmn2r26	T	A	6: 124,061,472	F669I	probably damaging	Het
Wdr95	G	A	5: 149,595,396		probably null	Het
Wfdc8	T	G	2: 164,608,869		probably benign	Het
Zfp64	A	C	2: 168,926,318	V458G	probably benign	Het
Zfp868	C	T	8: 69,611,868	G272D	probably damaging	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69357062	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69346629	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69357383	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69349871	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69359965	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69357731	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69353211	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69359980	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69348742	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69358234	unclassified	probably benign
IGL01635:Chd3	APN	11	69361250	splice site	probably benign
IGL01942:Chd3	APN	11	69350105	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69357493	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69360675	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69361060	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69359829	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69352094	unclassified	probably benign
IGL02415:Chd3	APN	11	69348913	splice site	probably benign
IGL02648:Chd3	APN	11	69352150	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69361048	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69354404	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69361196	nonsense	probably null
IGL03168:Chd3	APN	11	69348915	splice site	probably benign
IGL03327:Chd3	APN	11	69350186	missense	probably damaging	1.00
burg	UTSW	11	69356554	missense	probably damaging	1.00
castello	UTSW	11	69355822	critical splice acceptor site	probably benign
feste	UTSW	11	69354426	nonsense	probably null
Fortress	UTSW	11	69364050	nonsense	probably null
moat	UTSW	11	69359185	missense	probably damaging	0.98
Redoubt	UTSW	11	69353901	unclassified	probably benign
schloss	UTSW	11	69362060	nonsense	probably null
siege	UTSW	11	69357018	missense	probably damaging	1.00
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69359913	unclassified	probably benign
R0129:Chd3	UTSW	11	69348501	nonsense	probably null
R0130:Chd3	UTSW	11	69359830	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69357018	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69356333	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69357541	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69354105	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69361669	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69345487	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69347195	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69357574	splice site	probably null
R1484:Chd3	UTSW	11	69359899	missense	probably benign	0.17
R1748:Chd3	UTSW	11	69364697	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69353901	unclassified	probably benign
R1833:Chd3	UTSW	11	69354123	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69349052	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69349051	missense	probably benign
R2147:Chd3	UTSW	11	69349028	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69360645	missense	probably damaging	1.00
R2877:Chd3	UTSW	11	69361172	nonsense	probably null
R2879:Chd3	UTSW	11	69364098	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69360616	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69362147	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69364050	nonsense	probably null
R3845:Chd3	UTSW	11	69346759	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69359185	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69349001	missense	probably benign
R4115:Chd3	UTSW	11	69357517	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69349877	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69353209	nonsense	probably null
R4622:Chd3	UTSW	11	69349008	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69362187	unclassified	probably benign
R4635:Chd3	UTSW	11	69362187	unclassified	probably benign
R4859:Chd3	UTSW	11	69359896	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69354208	unclassified	probably benign
R5173:Chd3	UTSW	11	69369243	unclassified	probably benign
R5287:Chd3	UTSW	11	69349069	splice site	probably null
R5403:Chd3	UTSW	11	69349069	splice site	probably null
R5511:Chd3	UTSW	11	69361475	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69353351	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69361435	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69352118	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69349237	missense	probably benign
R6211:Chd3	UTSW	11	69352677	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69356554	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69345535	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69353778	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69361684	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69364031	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69352545	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69350112	nonsense	probably null
R6548:Chd3	UTSW	11	69362060	nonsense	probably null
R6582:Chd3	UTSW	11	69369156	unclassified	probably benign
R6721:Chd3	UTSW	11	69369219	unclassified	probably benign
R6776:Chd3	UTSW	11	69354470	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69369201	missense	unknown
R7136:Chd3	UTSW	11	69348438	missense	probably null	0.37
R7164:Chd3	UTSW	11	69362306	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69364095	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69369211	missense	unknown
R7238:Chd3	UTSW	11	69364047	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69345568	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69356270	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69357866	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69355633	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69353238	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69356625	missense	probably benign	0.13
R8150:Chd3	UTSW	11	69363684	missense	probably benign	0.02
R8161:Chd3	UTSW	11	69350885	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69360657	missense	probably damaging	1.00
R8334:Chd3	UTSW	11	69350796	missense	probably damaging	1.00
R8423:Chd3	UTSW	11	69354426	nonsense	probably null
R8690:Chd3	UTSW	11	69355822	critical splice acceptor site	probably benign
R8828:Chd3	UTSW	11	69356271	missense	probably damaging	1.00
R8857:Chd3	UTSW	11	69362320	missense	probably benign	0.22
R9124:Chd3	UTSW	11	69369336	missense	unknown
R9170:Chd3	UTSW	11	69350822	missense	possibly damaging	0.64
R9213:Chd3	UTSW	11	69364802	missense	possibly damaging	0.53
R9285:Chd3	UTSW	11	69359128	missense	possibly damaging	0.64
R9293:Chd3	UTSW	11	69353201	missense	possibly damaging	0.94
R9368:Chd3	UTSW	11	69360374	missense	probably damaging	1.00
R9521:Chd3	UTSW	11	69358307	missense	probably benign	0.01
R9544:Chd3	UTSW	11	69350220	missense	probably damaging	1.00
R9554:Chd3	UTSW	11	69360189	missense	probably damaging	1.00
R9588:Chd3	UTSW	11	69350220	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69356258	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64
Z1186:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1186:Chd3	UTSW	11	69361451	missense	probably benign
Z1187:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1187:Chd3	UTSW	11	69361451	missense	probably benign
Z1188:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1188:Chd3	UTSW	11	69361451	missense	probably benign
Z1189:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1189:Chd3	UTSW	11	69361451	missense	probably benign
Z1190:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1190:Chd3	UTSW	11	69361451	missense	probably benign
Z1191:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1191:Chd3	UTSW	11	69361451	missense	probably benign
Z1192:Chd3	UTSW	11	69348445	missense	probably benign	0.00
Z1192:Chd3	UTSW	11	69361451	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCATAAGCCCCACTGGGGAGTTTAG -3'
(R):5'- CCATGCAGAAGTGAGACTTGGGAC -3'

Sequencing Primer
(F):5'- CCACTGGGGAGTTTAGGAGAC -3'
(R):5'- gggaggcagaggcagag -3'

Posted On

2014-05-23