Incidental Mutation 'R1741:Slc39a14'
ID 200376
Institutional Source Beutler Lab
Gene Symbol Slc39a14
Ensembl Gene ENSMUSG00000022094
Gene Name solute carrier family 39 (zinc transporter), member 14
Synonyms Zip14, G630015O18Rik
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 70303469-70351425 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70318744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 61 (K61R)
Ref Sequence ENSEMBL: ENSMUSP00000118319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022688] [ENSMUST00000068044] [ENSMUST00000127000] [ENSMUST00000139284] [ENSMUST00000143153] [ENSMUST00000151011] [ENSMUST00000152067] [ENSMUST00000152442]
AlphaFold Q75N73
Predicted Effect probably benign
Transcript: ENSMUST00000022688
AA Change: K61R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022688
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 4.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068044
AA Change: K61R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066108
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 5.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127000
AA Change: K61R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117792
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139284
AA Change: K61R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122615
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146453
Predicted Effect probably damaging
Transcript: ENSMUST00000151011
AA Change: K61R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118319
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152067
AA Change: K61R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119040
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 3.3e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152202
Predicted Effect probably damaging
Transcript: ENSMUST00000152442
AA Change: K61R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117010
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A14 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, scoliosis, osteopenia, short long bones, altered gluconeogenesis and chondrocyte differentiation, low plasma IGF-I and liver zinc levels. Homozygotes for another null allele show reduced liver zinc levels and hepatocyte proliferation after hepatectomy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Slc39a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Slc39a14 APN 14 70306685 missense possibly damaging 0.91
IGL02348:Slc39a14 APN 14 70316436 critical splice donor site probably null
IGL03108:Slc39a14 APN 14 70318919 missense probably damaging 0.98
IGL03391:Slc39a14 APN 14 70309842 missense probably damaging 1.00
R2437:Slc39a14 UTSW 14 70316436 critical splice donor site probably null
R4726:Slc39a14 UTSW 14 70313599 critical splice donor site probably null
R4808:Slc39a14 UTSW 14 70315801 missense probably damaging 1.00
R4911:Slc39a14 UTSW 14 70309922 missense probably benign 0.00
R4957:Slc39a14 UTSW 14 70315811 missense probably damaging 0.99
R5815:Slc39a14 UTSW 14 70306745 missense probably damaging 1.00
R6393:Slc39a14 UTSW 14 70309813 missense probably benign 0.02
R6464:Slc39a14 UTSW 14 70306728 missense probably damaging 0.98
R6466:Slc39a14 UTSW 14 70309886 missense probably damaging 1.00
R6757:Slc39a14 UTSW 14 70310884 missense probably damaging 1.00
R6969:Slc39a14 UTSW 14 70308826 missense probably damaging 0.99
R7569:Slc39a14 UTSW 14 70309827 missense possibly damaging 0.66
R7711:Slc39a14 UTSW 14 70313675 missense probably damaging 1.00
R7830:Slc39a14 UTSW 14 70310117 missense probably benign 0.00
R8075:Slc39a14 UTSW 14 70308798 missense possibly damaging 0.87
R9171:Slc39a14 UTSW 14 70310238 missense probably benign 0.01
R9371:Slc39a14 UTSW 14 70310120 missense probably benign
R9576:Slc39a14 UTSW 14 70318786 missense probably benign
R9653:Slc39a14 UTSW 14 70309799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCCTGAGGATGAAGAATATGC -3'
(R):5'- AGATAGAGACCTTGCCTTCACCTGG -3'

Sequencing Primer
(F):5'- TATGCTGACCCCAGTGAAGATG -3'
(R):5'- TGGTCACCATGAAGCGG -3'
Posted On 2014-05-23