Incidental Mutation 'R1741:Slc39a14'
ID 200376
Institutional Source Beutler Lab
Gene Symbol Slc39a14
Ensembl Gene ENSMUSG00000022094
Gene Name solute carrier family 39 (zinc transporter), member 14
Synonyms Zip14, G630015O18Rik
MMRRC Submission 039773-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 70540918-70588874 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70556193 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 61 (K61R)
Ref Sequence ENSEMBL: ENSMUSP00000118319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022688] [ENSMUST00000068044] [ENSMUST00000127000] [ENSMUST00000139284] [ENSMUST00000143153] [ENSMUST00000152067] [ENSMUST00000152442] [ENSMUST00000151011]
AlphaFold Q75N73
Predicted Effect probably benign
Transcript: ENSMUST00000022688
AA Change: K61R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022688
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 4.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068044
AA Change: K61R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066108
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 5.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127000
AA Change: K61R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117792
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139284
AA Change: K61R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122615
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145040
Predicted Effect probably benign
Transcript: ENSMUST00000152067
AA Change: K61R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119040
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 3.3e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152442
AA Change: K61R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117010
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151011
AA Change: K61R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118319
Gene: ENSMUSG00000022094
AA Change: K61R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146453
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A14 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, scoliosis, osteopenia, short long bones, altered gluconeogenesis and chondrocyte differentiation, low plasma IGF-I and liver zinc levels. Homozygotes for another null allele show reduced liver zinc levels and hepatocyte proliferation after hepatectomy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,793,578 (GRCm39) N37S probably damaging Het
Acad10 T C 5: 121,785,899 (GRCm39) K230R probably damaging Het
Actl7a A G 4: 56,744,252 (GRCm39) N260D probably benign Het
Adam24 T C 8: 41,132,642 (GRCm39) Y37H probably benign Het
Ahcy G A 2: 154,906,154 (GRCm39) A229V probably benign Het
Ap3b2 A G 7: 81,117,347 (GRCm39) V563A possibly damaging Het
Bcl9l T A 9: 44,420,986 (GRCm39) M1427K probably damaging Het
Btf3 C T 13: 98,452,804 (GRCm39) M1I probably null Het
Btg4 A T 9: 51,027,910 (GRCm39) I27L probably benign Het
Ccdc171 A G 4: 83,539,076 (GRCm39) Y366C probably damaging Het
Chd3 A G 11: 69,246,480 (GRCm39) Y1085H probably damaging Het
Cnot10 T C 9: 114,426,892 (GRCm39) D616G possibly damaging Het
Crlf1 C A 8: 70,953,556 (GRCm39) D243E probably damaging Het
Cyp2b23 A G 7: 26,372,502 (GRCm39) V371A possibly damaging Het
Dennd2a A G 6: 39,470,091 (GRCm39) S534P probably damaging Het
Eln A G 5: 134,758,038 (GRCm39) V185A unknown Het
Epor C T 9: 21,871,067 (GRCm39) G301D probably damaging Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Fbxl21 A T 13: 56,684,915 (GRCm39) T340S probably benign Het
Fcgbpl1 G T 7: 27,857,279 (GRCm39) C2209F probably damaging Het
Fez1 T A 9: 36,755,029 (GRCm39) D9E probably damaging Het
Fsip2 T C 2: 82,820,256 (GRCm39) F5330L probably benign Het
Glis1 G A 4: 107,425,544 (GRCm39) R197Q probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gpr158 A G 2: 21,832,359 (GRCm39) N1153S probably benign Het
Gramd4 T C 15: 85,975,730 (GRCm39) probably null Het
Hhatl T A 9: 121,618,125 (GRCm39) Y210F possibly damaging Het
Hltf T C 3: 20,140,352 (GRCm39) W422R probably damaging Het
Hspa5 T C 2: 34,662,704 (GRCm39) S87P possibly damaging Het
Il21 T C 3: 37,281,811 (GRCm39) H111R probably benign Het
Ip6k1 G A 9: 107,918,183 (GRCm39) G73S probably benign Het
Kdm5b A G 1: 134,545,755 (GRCm39) D972G possibly damaging Het
Kif21b C T 1: 136,083,880 (GRCm39) A709V probably damaging Het
Kmt2d T C 15: 98,743,115 (GRCm39) probably benign Het
Lrrc14b A G 13: 74,511,705 (GRCm39) L125P probably damaging Het
Mapk8ip3 A G 17: 25,118,828 (GRCm39) S1169P probably damaging Het
Me3 A T 7: 89,501,041 (GRCm39) Y584F probably damaging Het
Mxra7 T G 11: 116,707,070 (GRCm39) probably null Het
Nf1 T C 11: 79,334,757 (GRCm39) S870P probably benign Het
Npr2 G A 4: 43,643,350 (GRCm39) G525S probably damaging Het
Nyap1 A T 5: 137,731,387 (GRCm39) S726T probably damaging Het
Padi4 A G 4: 140,473,481 (GRCm39) V652A probably damaging Het
Pclo A G 5: 14,726,524 (GRCm39) probably benign Het
Pgm1 G A 4: 99,822,062 (GRCm39) probably null Het
Piezo2 A G 18: 63,154,244 (GRCm39) S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 (GRCm39) D386E probably damaging Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 (GRCm39) V154A probably damaging Het
Rassf4 T C 6: 116,616,450 (GRCm39) E287G probably damaging Het
Rnh1 C T 7: 140,743,936 (GRCm39) R174H probably benign Het
Scn9a T A 2: 66,317,938 (GRCm39) I1517F probably damaging Het
Sftpb C A 6: 72,282,797 (GRCm39) A90E probably benign Het
Tmem132d A C 5: 127,861,922 (GRCm39) M733R probably benign Het
Tmem248 A G 5: 130,265,664 (GRCm39) I156V probably benign Het
Traf2 T C 2: 25,414,495 (GRCm39) D339G probably damaging Het
Trappc11 A G 8: 47,982,362 (GRCm39) probably null Het
Tuba8 T A 6: 121,199,727 (GRCm39) I137N possibly damaging Het
Txlnb A G 10: 17,714,695 (GRCm39) T376A probably damaging Het
Usp34 A G 11: 23,314,103 (GRCm39) T663A probably benign Het
Vmn2r26 T A 6: 124,038,431 (GRCm39) F669I probably damaging Het
Wdr95 G A 5: 149,518,861 (GRCm39) probably null Het
Wfdc8 T G 2: 164,450,789 (GRCm39) probably benign Het
Zfp64 A C 2: 168,768,238 (GRCm39) V458G probably benign Het
Zfp868 C T 8: 70,064,519 (GRCm39) G272D probably damaging Het
Other mutations in Slc39a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Slc39a14 APN 14 70,544,134 (GRCm39) missense possibly damaging 0.91
IGL02348:Slc39a14 APN 14 70,553,885 (GRCm39) critical splice donor site probably null
IGL03108:Slc39a14 APN 14 70,556,368 (GRCm39) missense probably damaging 0.98
IGL03391:Slc39a14 APN 14 70,547,291 (GRCm39) missense probably damaging 1.00
R2437:Slc39a14 UTSW 14 70,553,885 (GRCm39) critical splice donor site probably null
R4726:Slc39a14 UTSW 14 70,551,048 (GRCm39) critical splice donor site probably null
R4808:Slc39a14 UTSW 14 70,553,250 (GRCm39) missense probably damaging 1.00
R4911:Slc39a14 UTSW 14 70,547,371 (GRCm39) missense probably benign 0.00
R4957:Slc39a14 UTSW 14 70,553,260 (GRCm39) missense probably damaging 0.99
R5815:Slc39a14 UTSW 14 70,544,194 (GRCm39) missense probably damaging 1.00
R6393:Slc39a14 UTSW 14 70,547,262 (GRCm39) missense probably benign 0.02
R6464:Slc39a14 UTSW 14 70,544,177 (GRCm39) missense probably damaging 0.98
R6466:Slc39a14 UTSW 14 70,547,335 (GRCm39) missense probably damaging 1.00
R6757:Slc39a14 UTSW 14 70,548,333 (GRCm39) missense probably damaging 1.00
R6969:Slc39a14 UTSW 14 70,546,275 (GRCm39) missense probably damaging 0.99
R7569:Slc39a14 UTSW 14 70,547,276 (GRCm39) missense possibly damaging 0.66
R7711:Slc39a14 UTSW 14 70,551,124 (GRCm39) missense probably damaging 1.00
R7830:Slc39a14 UTSW 14 70,547,566 (GRCm39) missense probably benign 0.00
R8075:Slc39a14 UTSW 14 70,546,247 (GRCm39) missense possibly damaging 0.87
R9171:Slc39a14 UTSW 14 70,547,687 (GRCm39) missense probably benign 0.01
R9371:Slc39a14 UTSW 14 70,547,569 (GRCm39) missense probably benign
R9576:Slc39a14 UTSW 14 70,556,235 (GRCm39) missense probably benign
R9653:Slc39a14 UTSW 14 70,547,248 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCCTGAGGATGAAGAATATGC -3'
(R):5'- AGATAGAGACCTTGCCTTCACCTGG -3'

Sequencing Primer
(F):5'- TATGCTGACCCCAGTGAAGATG -3'
(R):5'- TGGTCACCATGAAGCGG -3'
Posted On 2014-05-23