Incidental Mutation 'R1741:Ptk2'
ID200377
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene NamePTK2 protein tyrosine kinase 2
SynonymsFRNK, FAK, Fadk
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location73205102-73423280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73242406 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 701 (V701A)
Ref Sequence ENSEMBL: ENSMUSP00000105663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000170939] [ENSMUST00000226988] [ENSMUST00000227395] [ENSMUST00000227686]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110036
AA Change: V701A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: V701A

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170939
AA Change: V701A

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126764
Gene: ENSMUSG00000022607
AA Change: V701A

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 287 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226742
Predicted Effect probably benign
Transcript: ENSMUST00000226988
AA Change: V701A

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000227395
AA Change: V11A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227569
Predicted Effect probably benign
Transcript: ENSMUST00000227686
AA Change: V27A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228628
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73262547 missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73295389 splice site probably benign
IGL01605:Ptk2 APN 15 73264339 splice site probably benign
IGL01631:Ptk2 APN 15 73216371 missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73229931 missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73242473 missense probably benign 0.05
IGL02441:Ptk2 APN 15 73320826 missense probably benign 0.16
IGL02471:Ptk2 APN 15 73298187 missense probably benign 0.41
IGL02621:Ptk2 APN 15 73206145 missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73236216 missense probably damaging 1.00
Shooter UTSW 15 73304444 missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R1254:Ptk2 UTSW 15 73229970 missense probably benign 0.01
R1291:Ptk2 UTSW 15 73210756 missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73292046 missense probably benign 0.01
R1608:Ptk2 UTSW 15 73262575 missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73262610 missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1725:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73210884 missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73215983 missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73236191 nonsense probably null
R2114:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73266116 missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73231919 missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73309849 missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73231976 missense probably benign 0.00
R4594:Ptk2 UTSW 15 73206196 missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73206225 missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73216096 splice site probably null
R4847:Ptk2 UTSW 15 73231956 missense probably benign
R5558:Ptk2 UTSW 15 73304445 missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73262564 nonsense probably null
R5858:Ptk2 UTSW 15 73321095 missense probably benign 0.12
R5951:Ptk2 UTSW 15 73303833 missense possibly damaging 0.88
R6014:Ptk2 UTSW 15 73304444 missense possibly damaging 0.83
R6027:Ptk2 UTSW 15 73229913 missense probably damaging 1.00
R6082:Ptk2 UTSW 15 73276865 missense probably damaging 1.00
R7025:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7031:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7032:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7077:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7078:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7079:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7090:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7091:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7092:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7136:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7137:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7798:Ptk2 UTSW 15 73295375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGCAGCATATCGGGCAATC -3'
(R):5'- TACAGTCAGCCGGAGACATGTAGG -3'

Sequencing Primer
(F):5'- AGCATATCGGGCAATCTACAG -3'
(R):5'- CCTTTTGAGTGAGGCTAGAAACC -3'
Posted On2014-05-23