Incidental Mutation 'R1741:Gramd4'
ID 200379
Institutional Source Beutler Lab
Gene Symbol Gramd4
Ensembl Gene ENSMUSG00000035900
Gene Name GRAM domain containing 4
Synonyms
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1741 (G1)
Quality Score 167
Status Not validated
Chromosome 15
Chromosomal Location 86057695-86137634 bp(+) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 86091529 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]
AlphaFold Q8CB44
Predicted Effect probably null
Transcript: ENSMUST00000088931
SMART Domains Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 132 190 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
GRAM 500 578 8.41e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123349
SMART Domains Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123474
Predicted Effect probably null
Transcript: ENSMUST00000138134
SMART Domains Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

DomainStartEndE-ValueType
coiled coil region 107 165 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
GRAM 475 553 3.86e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159271
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Gramd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Gramd4 APN 15 86127018 missense probably damaging 0.97
Grasping UTSW 15 86091503 missense probably damaging 0.99
R0053:Gramd4 UTSW 15 86130138 splice site probably benign
R0622:Gramd4 UTSW 15 86091389 missense probably damaging 1.00
R1401:Gramd4 UTSW 15 86125196 missense probably damaging 1.00
R1840:Gramd4 UTSW 15 86130192 critical splice donor site probably null
R1968:Gramd4 UTSW 15 86132905 missense probably damaging 1.00
R2909:Gramd4 UTSW 15 86122183 nonsense probably null
R4345:Gramd4 UTSW 15 86134893 missense probably damaging 1.00
R4431:Gramd4 UTSW 15 86130160 missense probably damaging 1.00
R4832:Gramd4 UTSW 15 86134856 missense probably benign
R5164:Gramd4 UTSW 15 86100831 missense probably benign 0.16
R5216:Gramd4 UTSW 15 86134785 critical splice acceptor site probably null
R5898:Gramd4 UTSW 15 86100784 missense probably damaging 1.00
R5959:Gramd4 UTSW 15 86127557 missense probably damaging 0.99
R6303:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6304:Gramd4 UTSW 15 86134919 missense possibly damaging 0.72
R6678:Gramd4 UTSW 15 86091503 missense probably damaging 0.99
R6678:Gramd4 UTSW 15 86091504 missense possibly damaging 0.52
R6980:Gramd4 UTSW 15 86131969 missense probably benign 0.17
R7371:Gramd4 UTSW 15 86135406 missense probably benign 0.04
R7557:Gramd4 UTSW 15 86100900 nonsense probably null
R7922:Gramd4 UTSW 15 86131958 missense probably benign 0.07
R8874:Gramd4 UTSW 15 86100892 missense probably damaging 0.97
R9127:Gramd4 UTSW 15 86091324 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGCTAAGTGCTCACCATCAGCC -3'
(R):5'- TGTACAGAAGTCCCACCTAGCCAAG -3'

Sequencing Primer
(F):5'- GCCTCAATATAGGGCTGGGAC -3'
(R):5'- ACCTAGCCAAGGGCCTG -3'
Posted On 2014-05-23