Mutagenetix > Incidental Mutation

Incidental Mutation 'R1741:Gramd4'

200379

Institutional Source

Beutler Lab

Gene Symbol

Gramd4

Ensembl Gene

ENSMUSG00000035900

Gene Name

GRAM domain containing 4

Synonyms

MMRRC Submission

039773-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1741 (G1)

Quality Score

167

Status

Not validated

Chromosome

Chromosomal Location

86057695-86137634 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 86091529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088931] [ENSMUST00000123349] [ENSMUST00000138134]

AlphaFold

Q8CB44

Predicted Effect

probably null
Transcript: ENSMUST00000088931

SMART Domains

Protein: ENSMUSP00000086321
Gene: ENSMUSG00000035900

Domain	Start	End	E-Value	Type
coiled coil region	132	190	N/A	INTRINSIC
transmembrane domain	301	323	N/A	INTRINSIC
transmembrane domain	400	422	N/A	INTRINSIC
GRAM	500	578	8.41e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123349

SMART Domains

Protein: ENSMUSP00000117468
Gene: ENSMUSG00000035900

Domain	Start	End	E-Value	Type
coiled coil region	107	165	N/A	INTRINSIC
transmembrane domain	276	298	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123474

Predicted Effect

probably null
Transcript: ENSMUST00000138134

SMART Domains

Protein: ENSMUSP00000120796
Gene: ENSMUSG00000035900

Domain	Start	End	E-Value	Type
coiled coil region	107	165	N/A	INTRINSIC
transmembrane domain	276	298	N/A	INTRINSIC
transmembrane domain	375	397	N/A	INTRINSIC
GRAM	475	553	3.86e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147286

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159271

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GRAMD4 is a mitochondrial effector of E2F1 (MIM 189971)-induced apoptosis (Stanelle et al., 2005 [PubMed 15565177]).[supplied by OMIM, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034E13Rik	A	G	18: 52,660,506	N37S	probably damaging	Het
9530053A07Rik	G	T	7: 28,157,854	C2209F	probably damaging	Het
Acad10	T	C	5: 121,647,836	K230R	probably damaging	Het
Actl7a	A	G	4: 56,744,252	N260D	probably benign	Het
Adam24	T	C	8: 40,679,603	Y37H	probably benign	Het
Ahcy	G	A	2: 155,064,234	A229V	probably benign	Het
Ap3b2	A	G	7: 81,467,599	V563A	possibly damaging	Het
Bcl9l	T	A	9: 44,509,689	M1427K	probably damaging	Het
Btf3	C	T	13: 98,316,296	M1I	probably null	Het
Btg4	A	T	9: 51,116,610	I27L	probably benign	Het
Ccdc171	A	G	4: 83,620,839	Y366C	probably damaging	Het
Chd3	A	G	11: 69,355,654	Y1085H	probably damaging	Het
Cnot10	T	C	9: 114,597,824	D616G	possibly damaging	Het
Crlf1	C	A	8: 70,500,906	D243E	probably damaging	Het
Cyp2b23	A	G	7: 26,673,077	V371A	possibly damaging	Het
Dennd2a	A	G	6: 39,493,157	S534P	probably damaging	Het
Eln	A	G	5: 134,729,184	V185A	unknown	Het
Epor	C	T	9: 21,959,771	G301D	probably damaging	Het
Fam83f	T	G	15: 80,692,267	V373G	possibly damaging	Het
Fbxl21	A	T	13: 56,537,102	T340S	probably benign	Het
Fez1	T	A	9: 36,843,733	D9E	probably damaging	Het
Fsip2	T	C	2: 82,989,912	F5330L	probably benign	Het
Glis1	G	A	4: 107,568,347	R197Q	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gpr158	A	G	2: 21,827,548	N1153S	probably benign	Het
Hhatl	T	A	9: 121,789,059	Y210F	possibly damaging	Het
Hltf	T	C	3: 20,086,188	W422R	probably damaging	Het
Hspa5	T	C	2: 34,772,692	S87P	possibly damaging	Het
Il21	T	C	3: 37,227,662	H111R	probably benign	Het
Ip6k1	G	A	9: 108,040,984	G73S	probably benign	Het
Kdm5b	A	G	1: 134,618,017	D972G	possibly damaging	Het
Kif21b	C	T	1: 136,156,142	A709V	probably damaging	Het
Kmt2d	T	C	15: 98,845,234		probably benign	Het
Lrrc14b	A	G	13: 74,363,586	L125P	probably damaging	Het
Mapk8ip3	A	G	17: 24,899,854	S1169P	probably damaging	Het
Me3	A	T	7: 89,851,833	Y584F	probably damaging	Het
Mxra7	T	G	11: 116,816,244		probably null	Het
Nf1	T	C	11: 79,443,931	S870P	probably benign	Het
Npr2	G	A	4: 43,643,350	G525S	probably damaging	Het
Nyap1	A	T	5: 137,733,125	S726T	probably damaging	Het
Padi4	A	G	4: 140,746,170	V652A	probably damaging	Het
Pclo	A	G	5: 14,676,510		probably benign	Het
Pgm2	G	A	4: 99,964,865		probably null	Het
Piezo2	A	G	18: 63,021,173	S2512P	probably damaging	Het
Ptbp3	A	T	4: 59,482,624	D386E	probably damaging	Het
Ptk2	A	G	15: 73,242,406	V701A	possibly damaging	Het
Ptpn3	A	G	4: 57,254,922	V154A	probably damaging	Het
Rassf4	T	C	6: 116,639,489	E287G	probably damaging	Het
Rnh1	C	T	7: 141,164,023	R174H	probably benign	Het
Scn9a	T	A	2: 66,487,594	I1517F	probably damaging	Het
Sftpb	C	A	6: 72,305,813	A90E	probably benign	Het
Slc39a14	T	C	14: 70,318,744	K61R	probably damaging	Het
Tmem132d	A	C	5: 127,784,858	M733R	probably benign	Het
Tmem248	A	G	5: 130,236,823	I156V	probably benign	Het
Traf2	T	C	2: 25,524,483	D339G	probably damaging	Het
Trappc11	A	G	8: 47,529,327		probably null	Het
Tuba8	T	A	6: 121,222,768	I137N	possibly damaging	Het
Txlnb	A	G	10: 17,838,947	T376A	probably damaging	Het
Usp34	A	G	11: 23,364,103	T663A	probably benign	Het
Vmn2r26	T	A	6: 124,061,472	F669I	probably damaging	Het
Wdr95	G	A	5: 149,595,396		probably null	Het
Wfdc8	T	G	2: 164,608,869		probably benign	Het
Zfp64	A	C	2: 168,926,318	V458G	probably benign	Het
Zfp868	C	T	8: 69,611,868	G272D	probably damaging	Het

Other mutations in Gramd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02983:Gramd4	APN	15	86127018	missense	probably damaging	0.97
Grasping	UTSW	15	86091503	missense	probably damaging	0.99
R0053:Gramd4	UTSW	15	86130138	splice site	probably benign
R0622:Gramd4	UTSW	15	86091389	missense	probably damaging	1.00
R1401:Gramd4	UTSW	15	86125196	missense	probably damaging	1.00
R1840:Gramd4	UTSW	15	86130192	critical splice donor site	probably null
R1968:Gramd4	UTSW	15	86132905	missense	probably damaging	1.00
R2909:Gramd4	UTSW	15	86122183	nonsense	probably null
R4345:Gramd4	UTSW	15	86134893	missense	probably damaging	1.00
R4431:Gramd4	UTSW	15	86130160	missense	probably damaging	1.00
R4832:Gramd4	UTSW	15	86134856	missense	probably benign
R5164:Gramd4	UTSW	15	86100831	missense	probably benign	0.16
R5216:Gramd4	UTSW	15	86134785	critical splice acceptor site	probably null
R5898:Gramd4	UTSW	15	86100784	missense	probably damaging	1.00
R5959:Gramd4	UTSW	15	86127557	missense	probably damaging	0.99
R6303:Gramd4	UTSW	15	86134919	missense	possibly damaging	0.72
R6304:Gramd4	UTSW	15	86134919	missense	possibly damaging	0.72
R6678:Gramd4	UTSW	15	86091503	missense	probably damaging	0.99
R6678:Gramd4	UTSW	15	86091504	missense	possibly damaging	0.52
R6980:Gramd4	UTSW	15	86131969	missense	probably benign	0.17
R7371:Gramd4	UTSW	15	86135406	missense	probably benign	0.04
R7557:Gramd4	UTSW	15	86100900	nonsense	probably null
R7922:Gramd4	UTSW	15	86131958	missense	probably benign	0.07
R8874:Gramd4	UTSW	15	86100892	missense	probably damaging	0.97
R9127:Gramd4	UTSW	15	86091324	missense	probably benign	0.00
R9652:Gramd4	UTSW	15	86131959	missense	probably damaging	0.97
R9711:Gramd4	UTSW	15	86130550	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGCTAAGTGCTCACCATCAGCC -3'
(R):5'- TGTACAGAAGTCCCACCTAGCCAAG -3'

Sequencing Primer
(F):5'- GCCTCAATATAGGGCTGGGAC -3'
(R):5'- ACCTAGCCAAGGGCCTG -3'

Posted On

2014-05-23