Incidental Mutation 'R1741:Mapk8ip3'
ID200381
Institutional Source Beutler Lab
Gene Symbol Mapk8ip3
Ensembl Gene ENSMUSG00000024163
Gene Namemitogen-activated protein kinase 8 interacting protein 3
SynonymsJSAP1, Syd2, JNK-interacting protein 3, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, D17Wsu15e, Jip3, JSAP1a, JSAP1b, JSAP1c, sunday driver 2, JSAP1d, JUN/SAPK-associated protein 1
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24892153-24936977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24899854 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1169 (S1169P)
Ref Sequence ENSEMBL: ENSMUSP00000114802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024978] [ENSMUST00000043907] [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000119115] [ENSMUST00000119848] [ENSMUST00000120035] [ENSMUST00000121542] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000139754] [ENSMUST00000146923] [ENSMUST00000154236] [ENSMUST00000178969]
Predicted Effect probably benign
Transcript: ENSMUST00000024978
SMART Domains Protein: ENSMUSP00000024978
Gene: ENSMUSG00000073435

DomainStartEndE-ValueType
NDK 21 158 1.06e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043907
SMART Domains Protein: ENSMUSP00000045111
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MRP-S34 61 187 5.3e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088345
AA Change: S1169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163
AA Change: S1169P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115228
AA Change: S1154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163
AA Change: S1154P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115229
AA Change: S1177P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163
AA Change: S1177P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117509
AA Change: S1146P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163
AA Change: S1146P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119115
AA Change: S1137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112955
Gene: ENSMUSG00000024163
AA Change: S1137P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.3e-72 PFAM
low complexity region 229 238 N/A INTRINSIC
PDB:2W83|D 385 440 7e-20 PDB
coiled coil region 493 523 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 861 869 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
SCOP:d1flga_ 955 1135 3e-8 SMART
Blast:WD40 1043 1084 5e-18 BLAST
low complexity region 1228 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119848
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120035
AA Change: S1168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114084
Gene: ENSMUSG00000024163
AA Change: S1168P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 235 248 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
PDB:2W83|D 416 471 6e-20 PDB
coiled coil region 524 554 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 892 900 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
SCOP:d1flga_ 986 1166 3e-8 SMART
Blast:WD40 1074 1115 6e-18 BLAST
low complexity region 1259 1275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121542
SMART Domains Protein: ENSMUSP00000113936
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 1.4e-23 SMART
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121723
AA Change: S1138P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163
AA Change: S1138P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121787
AA Change: S1132P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163
AA Change: S1132P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138648
Predicted Effect probably benign
Transcript: ENSMUST00000139754
SMART Domains Protein: ENSMUSP00000118245
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145688
Predicted Effect probably damaging
Transcript: ENSMUST00000146923
AA Change: S1169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163
AA Change: S1169P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150500
Predicted Effect probably benign
Transcript: ENSMUST00000154236
SMART Domains Protein: ENSMUSP00000120985
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
Blast:NDK 172 208 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156663
Predicted Effect probably damaging
Transcript: ENSMUST00000178969
AA Change: S1169P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163
AA Change: S1169P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the product of Drosophila syd gene, required for the functional interaction of kinesin I with axonal cargo. Studies of the similar gene in mouse suggested that this protein may interact with, and regulate the activity of numerous protein kinases of the JNK signaling pathway, and thus function as a scaffold protein in neuronal cells. The C. elegans counterpart of this gene is found to regulate synaptic vesicle transport possibly by integrating JNK signaling and kinesin-1 transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in impaired lung morphogenesis, causes absence of the telencephalic commissure with multiple defects in brain development and axon guidance, may affect synaptic transmission, and invariably leads to neonatal death due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Mapk8ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Mapk8ip3 APN 17 24900819 missense probably damaging 1.00
IGL01018:Mapk8ip3 APN 17 24899719 splice site probably benign
IGL01066:Mapk8ip3 APN 17 24901718 missense probably benign 0.00
IGL01656:Mapk8ip3 APN 17 24918029 missense probably damaging 0.99
IGL01991:Mapk8ip3 APN 17 24927861 missense possibly damaging 0.78
IGL02014:Mapk8ip3 APN 17 24903280 splice site probably benign
IGL02219:Mapk8ip3 APN 17 24899558 missense probably damaging 1.00
IGL03006:Mapk8ip3 APN 17 24901515 missense probably benign
ANU74:Mapk8ip3 UTSW 17 24900577 missense possibly damaging 0.94
FR4737:Mapk8ip3 UTSW 17 24902119 intron probably null
R0028:Mapk8ip3 UTSW 17 24904897 splice site probably benign
R0401:Mapk8ip3 UTSW 17 24909171 intron probably benign
R0496:Mapk8ip3 UTSW 17 24914450 splice site probably benign
R1456:Mapk8ip3 UTSW 17 24906949 missense probably damaging 1.00
R1503:Mapk8ip3 UTSW 17 24904923 missense probably damaging 1.00
R1554:Mapk8ip3 UTSW 17 24903059 missense probably benign 0.14
R1680:Mapk8ip3 UTSW 17 24901011 missense probably damaging 1.00
R1733:Mapk8ip3 UTSW 17 24936850 missense possibly damaging 0.70
R1750:Mapk8ip3 UTSW 17 24914459 missense probably null 1.00
R1774:Mapk8ip3 UTSW 17 24924145 critical splice donor site probably null
R1845:Mapk8ip3 UTSW 17 24914583 missense probably benign 0.29
R1911:Mapk8ip3 UTSW 17 24904051 missense probably benign 0.00
R1993:Mapk8ip3 UTSW 17 24914588 missense probably damaging 1.00
R2512:Mapk8ip3 UTSW 17 24914703 nonsense probably null
R2656:Mapk8ip3 UTSW 17 24912807 missense probably damaging 1.00
R2990:Mapk8ip3 UTSW 17 24905292 missense probably benign 0.00
R4587:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4617:Mapk8ip3 UTSW 17 24904787 missense probably damaging 1.00
R4627:Mapk8ip3 UTSW 17 24903293 missense probably benign
R4649:Mapk8ip3 UTSW 17 24904752 missense probably damaging 1.00
R4868:Mapk8ip3 UTSW 17 24901415 missense probably benign 0.04
R4903:Mapk8ip3 UTSW 17 24901209 missense probably benign
R4915:Mapk8ip3 UTSW 17 24909153 missense possibly damaging 0.75
R5447:Mapk8ip3 UTSW 17 24899189 missense probably benign
R5642:Mapk8ip3 UTSW 17 24903311 missense possibly damaging 0.63
R6320:Mapk8ip3 UTSW 17 24906905 missense probably damaging 0.99
R6900:Mapk8ip3 UTSW 17 24909123 intron probably null
R7178:Mapk8ip3 UTSW 17 24901754 missense probably benign 0.02
R7273:Mapk8ip3 UTSW 17 24906174 missense probably benign 0.00
R7317:Mapk8ip3 UTSW 17 24901718 missense probably benign 0.00
R7323:Mapk8ip3 UTSW 17 24901161 missense probably benign
R7701:Mapk8ip3 UTSW 17 24901404 missense possibly damaging 0.93
R7873:Mapk8ip3 UTSW 17 24906172 missense probably benign 0.01
R7956:Mapk8ip3 UTSW 17 24906172 missense probably benign 0.01
R8070:Mapk8ip3 UTSW 17 24901104 critical splice donor site probably null
X0024:Mapk8ip3 UTSW 17 24903973 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCCACGTTATTTTCAGCAGGCAG -3'
(R):5'- GGATGTGCCAAGCAAAAGCACC -3'

Sequencing Primer
(F):5'- GTACCCAGCACTTACCTCGG -3'
(R):5'- ACCCATTACTGACTGCACTG -3'
Posted On2014-05-23