Incidental Mutation 'R1741:Mapk8ip3'
ID 200381
Institutional Source Beutler Lab
Gene Symbol Mapk8ip3
Ensembl Gene ENSMUSG00000024163
Gene Name mitogen-activated protein kinase 8 interacting protein 3
Synonyms JSAP1c, JSAP1b, JNK-interacting protein 3, Jip3, D17Wsu15e, JSAP1, JSAP1d, Syd2, sunday driver 2, JSAP1a, JUN/SAPK-associated protein 1, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1
MMRRC Submission 039773-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.843) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 25116480-25155951 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25118828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1169 (S1169P)
Ref Sequence ENSEMBL: ENSMUSP00000114802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024978] [ENSMUST00000043907] [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000119115] [ENSMUST00000119848] [ENSMUST00000120035] [ENSMUST00000146923] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000139754] [ENSMUST00000121542] [ENSMUST00000154236] [ENSMUST00000178969]
AlphaFold Q9ESN9
Predicted Effect probably benign
Transcript: ENSMUST00000024978
SMART Domains Protein: ENSMUSP00000024978
Gene: ENSMUSG00000073435

DomainStartEndE-ValueType
NDK 21 158 1.06e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043907
SMART Domains Protein: ENSMUSP00000045111
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MRP-S34 61 187 5.3e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088345
AA Change: S1169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163
AA Change: S1169P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115228
AA Change: S1154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163
AA Change: S1154P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115229
AA Change: S1177P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163
AA Change: S1177P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117509
AA Change: S1146P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163
AA Change: S1146P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119115
AA Change: S1137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112955
Gene: ENSMUSG00000024163
AA Change: S1137P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.3e-72 PFAM
low complexity region 229 238 N/A INTRINSIC
PDB:2W83|D 385 440 7e-20 PDB
coiled coil region 493 523 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 861 869 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
SCOP:d1flga_ 955 1135 3e-8 SMART
Blast:WD40 1043 1084 5e-18 BLAST
low complexity region 1228 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119848
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120035
AA Change: S1168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114084
Gene: ENSMUSG00000024163
AA Change: S1168P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 235 248 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
PDB:2W83|D 416 471 6e-20 PDB
coiled coil region 524 554 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 892 900 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
SCOP:d1flga_ 986 1166 3e-8 SMART
Blast:WD40 1074 1115 6e-18 BLAST
low complexity region 1259 1275 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146923
AA Change: S1169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163
AA Change: S1169P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121723
AA Change: S1138P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163
AA Change: S1138P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121787
AA Change: S1132P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163
AA Change: S1132P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132258
Predicted Effect probably benign
Transcript: ENSMUST00000139754
SMART Domains Protein: ENSMUSP00000118245
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121542
SMART Domains Protein: ENSMUSP00000113936
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 1.4e-23 SMART
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154236
SMART Domains Protein: ENSMUSP00000120985
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
Blast:NDK 172 208 3e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000178969
AA Change: S1169P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163
AA Change: S1169P

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156659
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the product of Drosophila syd gene, required for the functional interaction of kinesin I with axonal cargo. Studies of the similar gene in mouse suggested that this protein may interact with, and regulate the activity of numerous protein kinases of the JNK signaling pathway, and thus function as a scaffold protein in neuronal cells. The C. elegans counterpart of this gene is found to regulate synaptic vesicle transport possibly by integrating JNK signaling and kinesin-1 transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in impaired lung morphogenesis, causes absence of the telencephalic commissure with multiple defects in brain development and axon guidance, may affect synaptic transmission, and invariably leads to neonatal death due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,793,578 (GRCm39) N37S probably damaging Het
Acad10 T C 5: 121,785,899 (GRCm39) K230R probably damaging Het
Actl7a A G 4: 56,744,252 (GRCm39) N260D probably benign Het
Adam24 T C 8: 41,132,642 (GRCm39) Y37H probably benign Het
Ahcy G A 2: 154,906,154 (GRCm39) A229V probably benign Het
Ap3b2 A G 7: 81,117,347 (GRCm39) V563A possibly damaging Het
Bcl9l T A 9: 44,420,986 (GRCm39) M1427K probably damaging Het
Btf3 C T 13: 98,452,804 (GRCm39) M1I probably null Het
Btg4 A T 9: 51,027,910 (GRCm39) I27L probably benign Het
Ccdc171 A G 4: 83,539,076 (GRCm39) Y366C probably damaging Het
Chd3 A G 11: 69,246,480 (GRCm39) Y1085H probably damaging Het
Cnot10 T C 9: 114,426,892 (GRCm39) D616G possibly damaging Het
Crlf1 C A 8: 70,953,556 (GRCm39) D243E probably damaging Het
Cyp2b23 A G 7: 26,372,502 (GRCm39) V371A possibly damaging Het
Dennd2a A G 6: 39,470,091 (GRCm39) S534P probably damaging Het
Eln A G 5: 134,758,038 (GRCm39) V185A unknown Het
Epor C T 9: 21,871,067 (GRCm39) G301D probably damaging Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Fbxl21 A T 13: 56,684,915 (GRCm39) T340S probably benign Het
Fcgbpl1 G T 7: 27,857,279 (GRCm39) C2209F probably damaging Het
Fez1 T A 9: 36,755,029 (GRCm39) D9E probably damaging Het
Fsip2 T C 2: 82,820,256 (GRCm39) F5330L probably benign Het
Glis1 G A 4: 107,425,544 (GRCm39) R197Q probably damaging Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gpr158 A G 2: 21,832,359 (GRCm39) N1153S probably benign Het
Gramd4 T C 15: 85,975,730 (GRCm39) probably null Het
Hhatl T A 9: 121,618,125 (GRCm39) Y210F possibly damaging Het
Hltf T C 3: 20,140,352 (GRCm39) W422R probably damaging Het
Hspa5 T C 2: 34,662,704 (GRCm39) S87P possibly damaging Het
Il21 T C 3: 37,281,811 (GRCm39) H111R probably benign Het
Ip6k1 G A 9: 107,918,183 (GRCm39) G73S probably benign Het
Kdm5b A G 1: 134,545,755 (GRCm39) D972G possibly damaging Het
Kif21b C T 1: 136,083,880 (GRCm39) A709V probably damaging Het
Kmt2d T C 15: 98,743,115 (GRCm39) probably benign Het
Lrrc14b A G 13: 74,511,705 (GRCm39) L125P probably damaging Het
Me3 A T 7: 89,501,041 (GRCm39) Y584F probably damaging Het
Mxra7 T G 11: 116,707,070 (GRCm39) probably null Het
Nf1 T C 11: 79,334,757 (GRCm39) S870P probably benign Het
Npr2 G A 4: 43,643,350 (GRCm39) G525S probably damaging Het
Nyap1 A T 5: 137,731,387 (GRCm39) S726T probably damaging Het
Padi4 A G 4: 140,473,481 (GRCm39) V652A probably damaging Het
Pclo A G 5: 14,726,524 (GRCm39) probably benign Het
Pgm1 G A 4: 99,822,062 (GRCm39) probably null Het
Piezo2 A G 18: 63,154,244 (GRCm39) S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 (GRCm39) D386E probably damaging Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 (GRCm39) V154A probably damaging Het
Rassf4 T C 6: 116,616,450 (GRCm39) E287G probably damaging Het
Rnh1 C T 7: 140,743,936 (GRCm39) R174H probably benign Het
Scn9a T A 2: 66,317,938 (GRCm39) I1517F probably damaging Het
Sftpb C A 6: 72,282,797 (GRCm39) A90E probably benign Het
Slc39a14 T C 14: 70,556,193 (GRCm39) K61R probably damaging Het
Tmem132d A C 5: 127,861,922 (GRCm39) M733R probably benign Het
Tmem248 A G 5: 130,265,664 (GRCm39) I156V probably benign Het
Traf2 T C 2: 25,414,495 (GRCm39) D339G probably damaging Het
Trappc11 A G 8: 47,982,362 (GRCm39) probably null Het
Tuba8 T A 6: 121,199,727 (GRCm39) I137N possibly damaging Het
Txlnb A G 10: 17,714,695 (GRCm39) T376A probably damaging Het
Usp34 A G 11: 23,314,103 (GRCm39) T663A probably benign Het
Vmn2r26 T A 6: 124,038,431 (GRCm39) F669I probably damaging Het
Wdr95 G A 5: 149,518,861 (GRCm39) probably null Het
Wfdc8 T G 2: 164,450,789 (GRCm39) probably benign Het
Zfp64 A C 2: 168,768,238 (GRCm39) V458G probably benign Het
Zfp868 C T 8: 70,064,519 (GRCm39) G272D probably damaging Het
Other mutations in Mapk8ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Mapk8ip3 APN 17 25,119,793 (GRCm39) missense probably damaging 1.00
IGL01018:Mapk8ip3 APN 17 25,118,693 (GRCm39) splice site probably benign
IGL01066:Mapk8ip3 APN 17 25,120,692 (GRCm39) missense probably benign 0.00
IGL01656:Mapk8ip3 APN 17 25,137,003 (GRCm39) missense probably damaging 0.99
IGL01991:Mapk8ip3 APN 17 25,146,835 (GRCm39) missense possibly damaging 0.78
IGL02014:Mapk8ip3 APN 17 25,122,254 (GRCm39) splice site probably benign
IGL02219:Mapk8ip3 APN 17 25,118,532 (GRCm39) missense probably damaging 1.00
IGL03006:Mapk8ip3 APN 17 25,120,489 (GRCm39) missense probably benign
ANU74:Mapk8ip3 UTSW 17 25,119,551 (GRCm39) missense possibly damaging 0.94
FR4737:Mapk8ip3 UTSW 17 25,121,093 (GRCm39) splice site probably null
R0028:Mapk8ip3 UTSW 17 25,123,871 (GRCm39) splice site probably benign
R0401:Mapk8ip3 UTSW 17 25,128,145 (GRCm39) intron probably benign
R0496:Mapk8ip3 UTSW 17 25,133,424 (GRCm39) splice site probably benign
R1456:Mapk8ip3 UTSW 17 25,125,923 (GRCm39) missense probably damaging 1.00
R1503:Mapk8ip3 UTSW 17 25,123,897 (GRCm39) missense probably damaging 1.00
R1554:Mapk8ip3 UTSW 17 25,122,033 (GRCm39) missense probably benign 0.14
R1680:Mapk8ip3 UTSW 17 25,119,985 (GRCm39) missense probably damaging 1.00
R1733:Mapk8ip3 UTSW 17 25,155,824 (GRCm39) missense possibly damaging 0.70
R1750:Mapk8ip3 UTSW 17 25,133,433 (GRCm39) missense probably null 1.00
R1774:Mapk8ip3 UTSW 17 25,143,119 (GRCm39) critical splice donor site probably null
R1845:Mapk8ip3 UTSW 17 25,133,557 (GRCm39) missense probably benign 0.29
R1911:Mapk8ip3 UTSW 17 25,123,025 (GRCm39) missense probably benign 0.00
R1993:Mapk8ip3 UTSW 17 25,133,562 (GRCm39) missense probably damaging 1.00
R2512:Mapk8ip3 UTSW 17 25,133,677 (GRCm39) nonsense probably null
R2656:Mapk8ip3 UTSW 17 25,131,781 (GRCm39) missense probably damaging 1.00
R2990:Mapk8ip3 UTSW 17 25,124,266 (GRCm39) missense probably benign 0.00
R4587:Mapk8ip3 UTSW 17 25,123,761 (GRCm39) missense probably damaging 1.00
R4617:Mapk8ip3 UTSW 17 25,123,761 (GRCm39) missense probably damaging 1.00
R4627:Mapk8ip3 UTSW 17 25,122,267 (GRCm39) missense probably benign
R4649:Mapk8ip3 UTSW 17 25,123,726 (GRCm39) missense probably damaging 1.00
R4868:Mapk8ip3 UTSW 17 25,120,389 (GRCm39) missense probably benign 0.04
R4903:Mapk8ip3 UTSW 17 25,120,183 (GRCm39) missense probably benign
R4915:Mapk8ip3 UTSW 17 25,128,127 (GRCm39) missense possibly damaging 0.75
R5447:Mapk8ip3 UTSW 17 25,118,163 (GRCm39) missense probably benign
R5642:Mapk8ip3 UTSW 17 25,122,285 (GRCm39) missense possibly damaging 0.63
R6320:Mapk8ip3 UTSW 17 25,125,879 (GRCm39) missense probably damaging 0.99
R6900:Mapk8ip3 UTSW 17 25,128,097 (GRCm39) splice site probably null
R7178:Mapk8ip3 UTSW 17 25,120,728 (GRCm39) missense probably benign 0.02
R7273:Mapk8ip3 UTSW 17 25,125,148 (GRCm39) missense probably benign 0.00
R7317:Mapk8ip3 UTSW 17 25,120,692 (GRCm39) missense probably benign 0.00
R7323:Mapk8ip3 UTSW 17 25,120,135 (GRCm39) missense probably benign
R7701:Mapk8ip3 UTSW 17 25,120,378 (GRCm39) missense possibly damaging 0.93
R7873:Mapk8ip3 UTSW 17 25,125,146 (GRCm39) missense probably benign 0.01
R8070:Mapk8ip3 UTSW 17 25,120,078 (GRCm39) critical splice donor site probably null
R8314:Mapk8ip3 UTSW 17 25,120,748 (GRCm39) missense probably benign 0.09
R8356:Mapk8ip3 UTSW 17 25,123,925 (GRCm39) missense probably damaging 1.00
R8441:Mapk8ip3 UTSW 17 25,139,474 (GRCm39) intron probably benign
R8537:Mapk8ip3 UTSW 17 25,120,652 (GRCm39) nonsense probably null
R8802:Mapk8ip3 UTSW 17 25,124,206 (GRCm39) missense probably damaging 1.00
R8864:Mapk8ip3 UTSW 17 25,118,492 (GRCm39) missense probably damaging 1.00
R8918:Mapk8ip3 UTSW 17 25,131,727 (GRCm39) missense probably damaging 1.00
R9312:Mapk8ip3 UTSW 17 25,146,925 (GRCm39) critical splice acceptor site probably null
R9599:Mapk8ip3 UTSW 17 25,118,124 (GRCm39) missense probably damaging 1.00
R9638:Mapk8ip3 UTSW 17 25,118,023 (GRCm39) missense probably benign
R9640:Mapk8ip3 UTSW 17 25,155,647 (GRCm39) missense possibly damaging 0.46
R9723:Mapk8ip3 UTSW 17 25,132,585 (GRCm39) missense possibly damaging 0.83
X0024:Mapk8ip3 UTSW 17 25,122,947 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCCACGTTATTTTCAGCAGGCAG -3'
(R):5'- GGATGTGCCAAGCAAAAGCACC -3'

Sequencing Primer
(F):5'- GTACCCAGCACTTACCTCGG -3'
(R):5'- ACCCATTACTGACTGCACTG -3'
Posted On 2014-05-23