Incidental Mutation 'R1742:Herc4'
ID200439
Institutional Source Beutler Lab
Gene Symbol Herc4
Ensembl Gene ENSMUSG00000020064
Gene Namehect domain and RLD 4
Synonyms
MMRRC Submission 039774-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R1742 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63243810-63317878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63287949 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 461 (N461K)
Ref Sequence ENSEMBL: ENSMUSP00000151886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020258] [ENSMUST00000219577]
Predicted Effect probably benign
Transcript: ENSMUST00000020258
AA Change: N461K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020258
Gene: ENSMUSG00000020064
AA Change: N461K

DomainStartEndE-ValueType
Pfam:RCC1 1 49 5.1e-11 PFAM
Pfam:RCC1_2 36 65 1.2e-9 PFAM
Pfam:RCC1 52 99 7.9e-16 PFAM
Pfam:RCC1_2 86 115 2.8e-11 PFAM
Pfam:RCC1 102 152 7.6e-18 PFAM
Pfam:RCC1_2 139 168 9.9e-14 PFAM
Pfam:RCC1 156 205 2.2e-15 PFAM
Pfam:RCC1_2 194 221 4.9e-10 PFAM
Pfam:RCC1 208 257 3.5e-17 PFAM
Pfam:RCC1 260 309 9.4e-14 PFAM
Pfam:RCC1 313 376 2.7e-8 PFAM
HECTc 720 1049 1.19e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218073
Predicted Effect probably benign
Transcript: ENSMUST00000219577
AA Change: N461K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220097
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele display reduced male fertility associated with a high percentage of angulated sperm tails and impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,740,395 probably null Het
Ankhd1 C A 18: 36,625,265 A1004E probably damaging Het
Arfgef2 A G 2: 166,866,980 S1071G probably damaging Het
Arhgef5 T A 6: 43,280,199 I1228N probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bptf A G 11: 107,110,951 V445A probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Bves C T 10: 45,347,865 T207M probably damaging Het
Ccdc171 T A 4: 83,681,284 S779T probably damaging Het
Ccdc54 T C 16: 50,590,238 K222E possibly damaging Het
Cebpe A G 14: 54,711,600 V120A probably benign Het
Clhc1 T A 11: 29,557,647 probably null Het
Col22a1 C T 15: 71,801,913 G985S unknown Het
Col6a3 T A 1: 90,813,794 I639F probably damaging Het
Cryga C A 1: 65,103,121 V38L probably benign Het
Dll3 T C 7: 28,294,423 T530A probably benign Het
Dnah7a G A 1: 53,456,684 P3205S probably benign Het
Dpp10 T A 1: 123,445,206 Y224F probably damaging Het
Fcrls T C 3: 87,259,043 T142A possibly damaging Het
Fyttd1 C T 16: 32,905,553 R175* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm11487 T C 4: 73,401,210 D99G probably damaging Het
Gm8332 C T 12: 88,249,683 D140N unknown Het
Gpr33 T C 12: 52,024,262 probably null Het
Gse1 T A 8: 120,566,950 V205E probably damaging Het
Ifi206 G A 1: 173,481,971 T153I probably benign Het
Iqca T C 1: 90,098,051 I341V probably benign Het
Itsn1 T G 16: 91,816,959 probably null Het
Kcnk5 T A 14: 20,141,857 Y412F probably benign Het
Lemd1 T A 1: 132,228,298 I26K probably damaging Het
Lipc A T 9: 70,820,529 L12Q probably damaging Het
Lrrtm1 C A 6: 77,244,091 P177Q probably damaging Het
Mcph1 G A 8: 18,607,363 G73R probably benign Het
Myh11 A T 16: 14,220,044 L899Q probably damaging Het
Myo18a G T 11: 77,841,467 R822L probably damaging Het
Nav3 T C 10: 109,769,213 T1000A probably benign Het
Nox4 T C 7: 87,295,818 V94A possibly damaging Het
Olfr1115 T A 2: 87,252,778 N280K probably benign Het
Olfr1230 G T 2: 89,296,424 P282H probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Oxr1 T C 15: 41,850,559 L679P probably damaging Het
Pcdhb17 T C 18: 37,486,576 I473T probably damaging Het
Pgbd5 T A 8: 124,380,307 E165D probably damaging Het
Pgpep1l A T 7: 68,237,054 V169D probably damaging Het
Phf12 C T 11: 78,009,486 T136I probably benign Het
Pif1 T A 9: 65,587,850 M14K probably benign Het
Pigr A G 1: 130,845,086 E347G probably damaging Het
Plekha3 G A 2: 76,682,879 E103K possibly damaging Het
Ptgs2 A G 1: 150,104,399 I363V probably damaging Het
Rasl11a T A 5: 146,846,995 probably null Het
Recql T C 6: 142,364,572 T511A probably damaging Het
Rgl2 T A 17: 33,937,223 probably null Het
Rpp25l T C 4: 41,712,763 Y4C probably damaging Het
Sass6 T G 3: 116,607,477 C156G probably damaging Het
Sgta T G 10: 81,046,277 N288T probably damaging Het
Slco1a4 T A 6: 141,825,045 T282S probably benign Het
Smad4 T C 18: 73,675,897 R100G probably damaging Het
Sox8 C T 17: 25,567,941 V263M probably damaging Het
Sp8 A G 12: 118,849,817 H469R probably benign Het
Spata1 A T 3: 146,469,623 probably null Het
Taar7a G A 10: 23,993,219 S88F probably damaging Het
Tnks2 T C 19: 36,876,261 L749S probably damaging Het
Tollip C A 7: 141,892,855 R19L probably damaging Het
Tox2 G A 2: 163,225,526 R55H probably benign Het
Vmn2r27 T C 6: 124,200,677 E456G possibly damaging Het
Vmn2r77 T A 7: 86,795,335 N65K probably benign Het
Vwf T C 6: 125,667,550 M2456T probably benign Het
Zfp526 A G 7: 25,224,514 N66S possibly damaging Het
Zic1 T C 9: 91,361,576 Y446C probably damaging Het
Other mutations in Herc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Herc4 APN 10 63273537 missense probably benign 0.01
IGL00977:Herc4 APN 10 63311567 missense probably damaging 1.00
IGL01455:Herc4 APN 10 63286143 critical splice donor site probably null
IGL01615:Herc4 APN 10 63290682 splice site probably benign
IGL01974:Herc4 APN 10 63299241 critical splice donor site probably null
IGL02207:Herc4 APN 10 63299244 splice site probably null
IGL02215:Herc4 APN 10 63273566 missense probably benign
IGL02331:Herc4 APN 10 63264160 missense probably benign
IGL02407:Herc4 APN 10 63306424 missense probably damaging 0.96
IGL02444:Herc4 APN 10 63306433 missense probably benign 0.00
IGL02498:Herc4 APN 10 63273465 missense probably benign 0.01
IGL02797:Herc4 APN 10 63316807 splice site probably null
IGL02804:Herc4 APN 10 63285675 missense probably benign 0.10
Boosted UTSW 10 63264171 nonsense probably null
handout UTSW 10 63315658 critical splice acceptor site probably null
R0499:Herc4 UTSW 10 63264032 missense probably damaging 1.00
R0655:Herc4 UTSW 10 63273571 missense probably benign 0.33
R0722:Herc4 UTSW 10 63286065 missense probably null 0.56
R0738:Herc4 UTSW 10 63289149 missense possibly damaging 0.93
R1776:Herc4 UTSW 10 63264171 nonsense probably null
R1792:Herc4 UTSW 10 63245901 start codon destroyed probably null 1.00
R1968:Herc4 UTSW 10 63273525 missense probably benign 0.43
R1992:Herc4 UTSW 10 63245964 missense possibly damaging 0.50
R2012:Herc4 UTSW 10 63244038 start gained probably benign
R2077:Herc4 UTSW 10 63264053 missense probably benign 0.04
R2103:Herc4 UTSW 10 63246110 missense probably benign 0.00
R2363:Herc4 UTSW 10 63315694 missense possibly damaging 0.96
R3833:Herc4 UTSW 10 63245960 missense probably benign
R4014:Herc4 UTSW 10 63287544 missense probably benign
R4084:Herc4 UTSW 10 63283237 missense probably damaging 1.00
R4855:Herc4 UTSW 10 63315658 critical splice acceptor site probably null
R4883:Herc4 UTSW 10 63285654 missense probably benign 0.00
R5215:Herc4 UTSW 10 63289097 missense probably benign 0.22
R5330:Herc4 UTSW 10 63307799 nonsense probably null
R5331:Herc4 UTSW 10 63307799 nonsense probably null
R5429:Herc4 UTSW 10 63275013 missense probably benign 0.01
R6058:Herc4 UTSW 10 63275042 missense possibly damaging 0.80
R6462:Herc4 UTSW 10 63289101 missense probably benign
R6502:Herc4 UTSW 10 63317418 missense probably benign 0.00
R6669:Herc4 UTSW 10 63286068 missense probably benign 0.00
R7161:Herc4 UTSW 10 63308415 missense probably benign 0.35
R7267:Herc4 UTSW 10 63273586 missense possibly damaging 0.64
R7740:Herc4 UTSW 10 63269678 missense probably benign 0.02
Z1176:Herc4 UTSW 10 63307749 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTACCtcctccccactcagcc -3'
(R):5'- ACAGTTGCCTAAGCATTGCGAAGAA -3'

Sequencing Primer
(F):5'- ccccactcagcctctcttac -3'
(R):5'- agccatctcaccagccc -3'
Posted On2014-05-23