Incidental Mutation 'R1742:Herc4'
ID200439
Institutional Source Beutler Lab
Gene Symbol Herc4
Ensembl Gene ENSMUSG00000020064
Gene Namehect domain and RLD 4
Synonyms
MMRRC Submission 039774-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R1742 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63243810-63317878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63287949 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 461 (N461K)
Ref Sequence ENSEMBL: ENSMUSP00000151886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020258] [ENSMUST00000219577]
Predicted Effect probably benign
Transcript: ENSMUST00000020258
AA Change: N461K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020258
Gene: ENSMUSG00000020064
AA Change: N461K

DomainStartEndE-ValueType
Pfam:RCC1 1 49 5.1e-11 PFAM
Pfam:RCC1_2 36 65 1.2e-9 PFAM
Pfam:RCC1 52 99 7.9e-16 PFAM
Pfam:RCC1_2 86 115 2.8e-11 PFAM
Pfam:RCC1 102 152 7.6e-18 PFAM
Pfam:RCC1_2 139 168 9.9e-14 PFAM
Pfam:RCC1 156 205 2.2e-15 PFAM
Pfam:RCC1_2 194 221 4.9e-10 PFAM
Pfam:RCC1 208 257 3.5e-17 PFAM
Pfam:RCC1 260 309 9.4e-14 PFAM
Pfam:RCC1 313 376 2.7e-8 PFAM
HECTc 720 1049 1.19e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218073
Predicted Effect probably benign
Transcript: ENSMUST00000219577
AA Change: N461K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220097
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele display reduced male fertility associated with a high percentage of angulated sperm tails and impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,740,395 probably null Het
Ankhd1 C A 18: 36,625,265 A1004E probably damaging Het
Arfgef2 A G 2: 166,866,980 S1071G probably damaging Het
Arhgef5 T A 6: 43,280,199 I1228N probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bptf A G 11: 107,110,951 V445A probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Bves C T 10: 45,347,865 T207M probably damaging Het
Ccdc171 T A 4: 83,681,284 S779T probably damaging Het
Ccdc54 T C 16: 50,590,238 K222E possibly damaging Het
Cebpe A G 14: 54,711,600 V120A probably benign Het
Clhc1 T A 11: 29,557,647 probably null Het
Col22a1 C T 15: 71,801,913 G985S unknown Het
Col6a3 T A 1: 90,813,794 I639F probably damaging Het
Cryga C A 1: 65,103,121 V38L probably benign Het
Dll3 T C 7: 28,294,423 T530A probably benign Het
Dnah7a G A 1: 53,456,684 P3205S probably benign Het
Dpp10 T A 1: 123,445,206 Y224F probably damaging Het
Fcrls T C 3: 87,259,043 T142A possibly damaging Het
Fyttd1 C T 16: 32,905,553 R175* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm11487 T C 4: 73,401,210 D99G probably damaging Het
Gm8332 C T 12: 88,249,683 D140N unknown Het
Gpr33 T C 12: 52,024,262 probably null Het
Gse1 T A 8: 120,566,950 V205E probably damaging Het
Ifi206 G A 1: 173,481,971 T153I probably benign Het
Iqca T C 1: 90,098,051 I341V probably benign Het
Itsn1 T G 16: 91,816,959 probably null Het
Kcnk5 T A 14: 20,141,857 Y412F probably benign Het
Lemd1 T A 1: 132,228,298 I26K probably damaging Het
Lipc A T 9: 70,820,529 L12Q probably damaging Het
Lrrtm1 C A 6: 77,244,091 P177Q probably damaging Het
Mcph1 G A 8: 18,607,363 G73R probably benign Het
Myh11 A T 16: 14,220,044 L899Q probably damaging Het
Myo18a G T 11: 77,841,467 R822L probably damaging Het
Nav3 T C 10: 109,769,213 T1000A probably benign Het
Nox4 T C 7: 87,295,818 V94A possibly damaging Het
Olfr1115 T A 2: 87,252,778 N280K probably benign Het
Olfr1230 G T 2: 89,296,424 P282H probably damaging Het
Olfr850 A G 9: 19,478,041 S67P probably damaging Het
Oxr1 T C 15: 41,850,559 L679P probably damaging Het
Pcdhb17 T C 18: 37,486,576 I473T probably damaging Het
Pgbd5 T A 8: 124,380,307 E165D probably damaging Het
Pgpep1l A T 7: 68,237,054 V169D probably damaging Het
Phf12 C T 11: 78,009,486 T136I probably benign Het
Pif1 T A 9: 65,587,850 M14K probably benign Het
Pigr A G 1: 130,845,086 E347G probably damaging Het
Plekha3 G A 2: 76,682,879 E103K possibly damaging Het
Ptgs2 A G 1: 150,104,399 I363V probably damaging Het
Rasl11a T A 5: 146,846,995 probably null Het
Recql T C 6: 142,364,572 T511A probably damaging Het
Rgl2 T A 17: 33,937,223 probably null Het
Rpp25l T C 4: 41,712,763 Y4C probably damaging Het
Sass6 T G 3: 116,607,477 C156G probably damaging Het
Sgta T G 10: 81,046,277 N288T probably damaging Het
Slco1a4 T A 6: 141,825,045 T282S probably benign Het
Smad4 T C 18: 73,675,897 R100G probably damaging Het
Sox8 C T 17: 25,567,941 V263M probably damaging Het
Sp8 A G 12: 118,849,817 H469R probably benign Het
Spata1 A T 3: 146,469,623 probably null Het
Taar7a G A 10: 23,993,219 S88F probably damaging Het
Tnks2 T C 19: 36,876,261 L749S probably damaging Het
Tollip C A 7: 141,892,855 R19L probably damaging Het
Tox2 G A 2: 163,225,526 R55H probably benign Het
Vmn2r27 T C 6: 124,200,677 E456G possibly damaging Het
Vmn2r77 T A 7: 86,795,335 N65K probably benign Het
Vwf T C 6: 125,667,550 M2456T probably benign Het
Zfp526 A G 7: 25,224,514 N66S possibly damaging Het
Zic1 T C 9: 91,361,576 Y446C probably damaging Het
Other mutations in Herc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Herc4 APN 10 63273537 missense probably benign 0.01
IGL00977:Herc4 APN 10 63311567 missense probably damaging 1.00
IGL01455:Herc4 APN 10 63286143 critical splice donor site probably null
IGL01615:Herc4 APN 10 63290682 splice site probably benign
IGL01974:Herc4 APN 10 63299241 critical splice donor site probably null
IGL02207:Herc4 APN 10 63299244 splice site probably null
IGL02215:Herc4 APN 10 63273566 missense probably benign
IGL02331:Herc4 APN 10 63264160 missense probably benign
IGL02407:Herc4 APN 10 63306424 missense probably damaging 0.96
IGL02444:Herc4 APN 10 63306433 missense probably benign 0.00
IGL02498:Herc4 APN 10 63273465 missense probably benign 0.01
IGL02797:Herc4 APN 10 63316807 splice site probably null
IGL02804:Herc4 APN 10 63285675 missense probably benign 0.10
Boosted UTSW 10 63264171 nonsense probably null
Factorial UTSW 10 63286068 missense probably benign 0.00
handout UTSW 10 63315658 critical splice acceptor site probably null
R0499:Herc4 UTSW 10 63264032 missense probably damaging 1.00
R0655:Herc4 UTSW 10 63273571 missense probably benign 0.33
R0722:Herc4 UTSW 10 63286065 missense probably null 0.56
R0738:Herc4 UTSW 10 63289149 missense possibly damaging 0.93
R1776:Herc4 UTSW 10 63264171 nonsense probably null
R1792:Herc4 UTSW 10 63245901 start codon destroyed probably null 1.00
R1968:Herc4 UTSW 10 63273525 missense probably benign 0.43
R1992:Herc4 UTSW 10 63245964 missense possibly damaging 0.50
R2012:Herc4 UTSW 10 63244038 start gained probably benign
R2077:Herc4 UTSW 10 63264053 missense probably benign 0.04
R2103:Herc4 UTSW 10 63246110 missense probably benign 0.00
R2363:Herc4 UTSW 10 63315694 missense possibly damaging 0.96
R3833:Herc4 UTSW 10 63245960 missense probably benign
R4014:Herc4 UTSW 10 63287544 missense probably benign
R4084:Herc4 UTSW 10 63283237 missense probably damaging 1.00
R4855:Herc4 UTSW 10 63315658 critical splice acceptor site probably null
R4883:Herc4 UTSW 10 63285654 missense probably benign 0.00
R5215:Herc4 UTSW 10 63289097 missense probably benign 0.22
R5330:Herc4 UTSW 10 63307799 nonsense probably null
R5331:Herc4 UTSW 10 63307799 nonsense probably null
R5429:Herc4 UTSW 10 63275013 missense probably benign 0.01
R6058:Herc4 UTSW 10 63275042 missense possibly damaging 0.80
R6462:Herc4 UTSW 10 63289101 missense probably benign
R6502:Herc4 UTSW 10 63317418 missense probably benign 0.00
R6669:Herc4 UTSW 10 63286068 missense probably benign 0.00
R7161:Herc4 UTSW 10 63308415 missense probably benign 0.35
R7267:Herc4 UTSW 10 63273586 missense possibly damaging 0.64
R7740:Herc4 UTSW 10 63269678 missense probably benign 0.02
R8515:Herc4 UTSW 10 63315786 missense probably benign 0.00
Z1176:Herc4 UTSW 10 63307749 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTACCtcctccccactcagcc -3'
(R):5'- ACAGTTGCCTAAGCATTGCGAAGAA -3'

Sequencing Primer
(F):5'- ccccactcagcctctcttac -3'
(R):5'- agccatctcaccagccc -3'
Posted On2014-05-23