Incidental Mutation 'R1742:Rgl2'
ID 200464
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 039774-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R1742 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation splice site (1687 bp from exon)
DNA Base Change (assembly) T to A at 34156197 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174426] [ENSMUST00000174048] [ENSMUST00000179418]
AlphaFold Q61193
Predicted Effect probably null
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: S762T

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: S762T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect silent
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect probably null
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C A 18: 36,758,318 (GRCm39) A1004E probably damaging Het
Arfgef2 A G 2: 166,708,900 (GRCm39) S1071G probably damaging Het
Arhgef5 T A 6: 43,257,133 (GRCm39) I1228N probably damaging Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Bptf A G 11: 107,001,777 (GRCm39) V445A probably damaging Het
Btf3 C T 13: 98,452,804 (GRCm39) M1I probably null Het
Bves C T 10: 45,223,961 (GRCm39) T207M probably damaging Het
Ccdc171 T A 4: 83,599,521 (GRCm39) S779T probably damaging Het
Ccdc54 T C 16: 50,410,601 (GRCm39) K222E possibly damaging Het
Cebpe A G 14: 54,949,057 (GRCm39) V120A probably benign Het
Clhc1 T A 11: 29,507,647 (GRCm39) probably null Het
Col22a1 C T 15: 71,673,762 (GRCm39) G985S unknown Het
Col6a3 T A 1: 90,741,516 (GRCm39) I639F probably damaging Het
Cryga C A 1: 65,142,280 (GRCm39) V38L probably benign Het
Dll3 T C 7: 27,993,848 (GRCm39) T530A probably benign Het
Dnaaf9 A T 2: 130,582,315 (GRCm39) probably null Het
Dnah7a G A 1: 53,495,843 (GRCm39) P3205S probably benign Het
Dpp10 T A 1: 123,372,935 (GRCm39) Y224F probably damaging Het
Eif1ad10 C T 12: 88,216,453 (GRCm39) D140N unknown Het
Fcrl2 T C 3: 87,166,350 (GRCm39) T142A possibly damaging Het
Fyttd1 C T 16: 32,725,923 (GRCm39) R175* probably null Het
Gm10277 TC T 11: 77,676,828 (GRCm39) probably null Het
Gpr33 T C 12: 52,071,045 (GRCm39) probably null Het
Gse1 T A 8: 121,293,689 (GRCm39) V205E probably damaging Het
Herc4 C A 10: 63,123,728 (GRCm39) N461K probably benign Het
Ifi206 G A 1: 173,309,537 (GRCm39) T153I probably benign Het
Iqca1 T C 1: 90,025,773 (GRCm39) I341V probably benign Het
Itsn1 T G 16: 91,613,847 (GRCm39) probably null Het
Kcnk5 T A 14: 20,191,925 (GRCm39) Y412F probably benign Het
Lemd1 T A 1: 132,156,036 (GRCm39) I26K probably damaging Het
Lipc A T 9: 70,727,811 (GRCm39) L12Q probably damaging Het
Lrrtm1 C A 6: 77,221,074 (GRCm39) P177Q probably damaging Het
Mcph1 G A 8: 18,657,379 (GRCm39) G73R probably benign Het
Msantd5f6 T C 4: 73,319,447 (GRCm39) D99G probably damaging Het
Myh11 A T 16: 14,037,908 (GRCm39) L899Q probably damaging Het
Myo18a G T 11: 77,732,293 (GRCm39) R822L probably damaging Het
Nav3 T C 10: 109,605,074 (GRCm39) T1000A probably benign Het
Nox4 T C 7: 86,945,026 (GRCm39) V94A possibly damaging Het
Or10ag53 T A 2: 87,083,122 (GRCm39) N280K probably benign Het
Or4c123 G T 2: 89,126,768 (GRCm39) P282H probably damaging Het
Or7g32 A G 9: 19,389,337 (GRCm39) S67P probably damaging Het
Oxr1 T C 15: 41,713,955 (GRCm39) L679P probably damaging Het
Pcdhb17 T C 18: 37,619,629 (GRCm39) I473T probably damaging Het
Pgbd5 T A 8: 125,107,046 (GRCm39) E165D probably damaging Het
Pgpep1l A T 7: 67,886,802 (GRCm39) V169D probably damaging Het
Phf12 C T 11: 77,900,312 (GRCm39) T136I probably benign Het
Pif1 T A 9: 65,495,132 (GRCm39) M14K probably benign Het
Pigr A G 1: 130,772,823 (GRCm39) E347G probably damaging Het
Plekha3 G A 2: 76,513,223 (GRCm39) E103K possibly damaging Het
Ptgs2 A G 1: 149,980,150 (GRCm39) I363V probably damaging Het
Rasl11a T A 5: 146,783,805 (GRCm39) probably null Het
Recql T C 6: 142,310,298 (GRCm39) T511A probably damaging Het
Rpp25l T C 4: 41,712,763 (GRCm39) Y4C probably damaging Het
Sass6 T G 3: 116,401,126 (GRCm39) C156G probably damaging Het
Sgta T G 10: 80,882,111 (GRCm39) N288T probably damaging Het
Slco1a4 T A 6: 141,770,771 (GRCm39) T282S probably benign Het
Smad4 T C 18: 73,808,968 (GRCm39) R100G probably damaging Het
Sox8 C T 17: 25,786,915 (GRCm39) V263M probably damaging Het
Sp8 A G 12: 118,813,552 (GRCm39) H469R probably benign Het
Spata1 A T 3: 146,175,378 (GRCm39) probably null Het
Taar7a G A 10: 23,869,117 (GRCm39) S88F probably damaging Het
Tnks2 T C 19: 36,853,661 (GRCm39) L749S probably damaging Het
Tollip C A 7: 141,446,592 (GRCm39) R19L probably damaging Het
Tox2 G A 2: 163,067,446 (GRCm39) R55H probably benign Het
Vmn2r27 T C 6: 124,177,636 (GRCm39) E456G possibly damaging Het
Vmn2r77 T A 7: 86,444,543 (GRCm39) N65K probably benign Het
Vwf T C 6: 125,644,513 (GRCm39) M2456T probably benign Het
Zfp526 A G 7: 24,923,939 (GRCm39) N66S possibly damaging Het
Zic1 T C 9: 91,243,629 (GRCm39) Y446C probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTTCTGAACCCACAGAGCTGACC -3'
(R):5'- ACCAGTACTCTTCCCAGCACAGATG -3'

Sequencing Primer
(F):5'- GAGCTGACCATCCCACACTC -3'
(R):5'- GTAAACAGGTGACTTCACTGTCC -3'
Posted On 2014-05-23