Incidental Mutation 'R1743:Ext2'
Institutional Source Beutler Lab
Gene Symbol Ext2
Ensembl Gene ENSMUSG00000027198
Gene Nameexostoses (multiple) 2
MMRRC Submission 039775-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1743 (G1)
Quality Score225
Status Not validated
Chromosomal Location93661028-93822568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93730225 bp
Amino Acid Change Glutamic Acid to Glycine at position 532 (E532G)
Ref Sequence ENSEMBL: ENSMUSP00000138956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028623] [ENSMUST00000125407] [ENSMUST00000184931]
Predicted Effect probably damaging
Transcript: ENSMUST00000028623
AA Change: E532G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028623
Gene: ENSMUSG00000027198
AA Change: E532G

transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 2.4e-59 PFAM
Pfam:Glyco_transf_64 456 701 1.1e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123649
Predicted Effect probably benign
Transcript: ENSMUST00000125407
SMART Domains Protein: ENSMUSP00000120291
Gene: ENSMUSG00000027198

transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 8.8e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184931
AA Change: E532G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198
AA Change: E532G

transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos lack heparan sulfate, initiate primitive streak formation but fail to form mesoderm, become growth arrested and die around gastrulation. Heterozygotes show various abnormalities in cartilage differentiation; about one-third form one or more exostoses on the ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T A 11: 53,368,695 M11K possibly damaging Het
Ank2 T C 3: 126,928,675 D88G probably damaging Het
Arhgap32 A G 9: 32,259,431 E1169G probably benign Het
Atp7b A T 8: 22,006,387 V865E probably damaging Het
Bcl2l13 T A 6: 120,848,543 Y13* probably null Het
Birc6 A G 17: 74,579,756 Q693R possibly damaging Het
Bub1 T C 2: 127,813,850 D520G probably damaging Het
Ccdc15 A T 9: 37,277,477 Y770* probably null Het
Cenpf T C 1: 189,654,263 E1940G probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cmya5 A G 13: 93,097,317 V421A probably benign Het
Cnnm1 A T 19: 43,471,913 Y698F possibly damaging Het
Cnst C T 1: 179,610,392 T507I probably benign Het
Coq8a T C 1: 180,182,229 M4V probably benign Het
Csmd3 A G 15: 48,622,089 L140P probably damaging Het
Cul2 A T 18: 3,426,851 I431F probably damaging Het
Dnah8 G T 17: 30,769,651 E3198D probably benign Het
Epn2 T A 11: 61,546,411 I112F possibly damaging Het
Fndc3a A T 14: 72,652,081 V37E probably damaging Het
Gabbr2 A G 4: 46,677,603 F759S possibly damaging Het
Ghr G A 15: 3,320,241 P485L probably benign Het
Glipr1l2 G T 10: 112,092,565 V122L probably benign Het
Gm13128 T C 4: 144,333,005 S429P probably benign Het
Gm6871 G T 7: 41,546,452 T287K probably damaging Het
Gm7275 A G 16: 48,073,757 noncoding transcript Het
Hephl1 C T 9: 15,090,068 V254I probably damaging Het
Hnf4a C A 2: 163,566,339 Q362K possibly damaging Het
Kcne3 C T 7: 100,184,424 R83C probably damaging Het
Klb C A 5: 65,375,861 N504K probably damaging Het
Loxl2 T A 14: 69,692,402 I743N possibly damaging Het
Lrrc9 A T 12: 72,456,117 L287F probably damaging Het
Mcm3ap C T 10: 76,484,674 P822L possibly damaging Het
Nacc2 T C 2: 26,060,143 N527S probably benign Het
Ncam1 G T 9: 49,557,145 P338H probably damaging Het
Nfkbiz G T 16: 55,816,394 Q515K possibly damaging Het
Nipsnap2 T C 5: 129,757,085 L263P probably damaging Het
Nlrp1a A T 11: 71,124,206 S73T probably benign Het
Nomo1 G A 7: 46,070,037 probably null Het
Nos3 G A 5: 24,377,312 G594D probably benign Het
Olfr1330 A G 4: 118,893,526 T148A probably benign Het
Olfr1359 A G 13: 21,703,450 I150V probably benign Het
Olfr148 A T 9: 39,613,620 T18S possibly damaging Het
Oprm1 A G 10: 6,830,105 I256V probably damaging Het
Oxct2a A T 4: 123,323,516 L24Q possibly damaging Het
Pcdhb14 T G 18: 37,448,178 S112R probably benign Het
Polr2a A G 11: 69,739,503 I1246T probably damaging Het
Ppil4 A T 10: 7,807,381 K327N probably damaging Het
Pstpip1 T C 9: 56,125,930 Y249H probably damaging Het
Qrsl1 A T 10: 43,881,515 V369E probably damaging Het
Ranbp10 G T 8: 105,779,978 P237T probably damaging Het
Rapgef6 A G 11: 54,676,284 N1097S probably damaging Het
Repin1 T A 6: 48,597,750 S538T probably damaging Het
Rims2 A T 15: 39,679,650 M1151L probably benign Het
Rin3 T A 12: 102,390,096 D965E possibly damaging Het
Sdc2 A G 15: 33,028,078 D114G probably benign Het
Slc25a30 C A 14: 75,775,083 A42S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssh2 T A 11: 77,437,756 F383I probably damaging Het
St8sia1 A T 6: 142,829,016 V279E probably damaging Het
Tacc2 C A 7: 130,626,598 S1690* probably null Het
Taf1b A G 12: 24,547,178 D372G possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem165 G T 5: 76,207,826 G272C probably damaging Het
Tsc22d2 TCAGTTAACACCTATGAACAGT TCAGT 3: 58,417,539 probably null Het
Tssk4 C A 14: 55,651,031 A119D probably damaging Het
Usp9y A G Y: 1,316,727 Y1941H probably damaging Het
Vmn2r42 A T 7: 8,184,265 M786K probably benign Het
Wdfy3 G T 5: 101,844,065 T3470K probably benign Het
Wdr63 C A 3: 146,097,262 R58L possibly damaging Het
Zc3h14 T C 12: 98,779,189 V479A probably benign Het
Zfp821 G A 8: 109,724,164 R263Q probably damaging Het
Other mutations in Ext2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Ext2 APN 2 93791073 missense probably benign
IGL01554:Ext2 APN 2 93811949 missense probably damaging 1.00
IGL01768:Ext2 APN 2 93791110 splice site probably benign
IGL02160:Ext2 APN 2 93813584 missense probably benign
IGL02677:Ext2 APN 2 93707245 missense probably damaging 1.00
IGL02939:Ext2 APN 2 93704619 splice site probably null
IGL03013:Ext2 APN 2 93707226 intron probably benign
IGL03286:Ext2 APN 2 93707272 missense probably damaging 1.00
R0018:Ext2 UTSW 2 93795692 missense probably damaging 1.00
R0526:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R0580:Ext2 UTSW 2 93795725 missense probably benign 0.31
R1383:Ext2 UTSW 2 93806113 missense possibly damaging 0.92
R1538:Ext2 UTSW 2 93707287 missense probably damaging 1.00
R1792:Ext2 UTSW 2 93704545 missense probably damaging 1.00
R2874:Ext2 UTSW 2 93739686 missense possibly damaging 0.95
R3122:Ext2 UTSW 2 93813825 missense probably damaging 1.00
R4624:Ext2 UTSW 2 93703200 missense probably benign 0.26
R4653:Ext2 UTSW 2 93696159 missense probably benign 0.22
R4826:Ext2 UTSW 2 93762630 missense probably benign 0.15
R4828:Ext2 UTSW 2 93795767 missense probably benign 0.08
R4936:Ext2 UTSW 2 93813679 nonsense probably null
R5311:Ext2 UTSW 2 93696261 missense probably benign 0.04
R5799:Ext2 UTSW 2 93811972 missense probably benign 0.01
R5850:Ext2 UTSW 2 93813659 missense possibly damaging 0.94
R6230:Ext2 UTSW 2 93762620 missense probably damaging 1.00
R6488:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R7047:Ext2 UTSW 2 93739657 missense probably damaging 0.99
R7173:Ext2 UTSW 2 93813612 missense probably damaging 1.00
R7391:Ext2 UTSW 2 93730267 missense probably damaging 1.00
R7530:Ext2 UTSW 2 93661653 missense probably benign 0.00
R7545:Ext2 UTSW 2 93813763 missense probably benign
R7939:Ext2 UTSW 2 93730256 missense probably damaging 1.00
R8160:Ext2 UTSW 2 93813762 missense probably benign 0.05
Z1177:Ext2 UTSW 2 93703275 critical splice acceptor site probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gatagtgcctcggtgagac -3'
Posted On2014-05-23