Incidental Mutation 'R1743:Hnf4a'
ID200481
Institutional Source Beutler Lab
Gene Symbol Hnf4a
Ensembl Gene ENSMUSG00000017950
Gene Namehepatic nuclear factor 4, alpha
SynonymsHNF-4, HNF4 alpha, Nuclear receptor 2A1, Tcf14, Nr2a1, MODY1, Tcf4, Hnf4
MMRRC Submission 039775-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1743 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location163506808-163572910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 163566339 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 362 (Q362K)
Ref Sequence ENSEMBL: ENSMUSP00000105038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018094] [ENSMUST00000109411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018094
AA Change: Q371K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018094
Gene: ENSMUSG00000017950
AA Change: Q371K

DomainStartEndE-ValueType
ZnF_C4 57 128 7.83e-38 SMART
HOLI 189 348 1.12e-47 SMART
low complexity region 383 393 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109411
AA Change: Q362K

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105038
Gene: ENSMUSG00000017950
AA Change: Q362K

DomainStartEndE-ValueType
ZnF_C4 48 119 7.83e-38 SMART
HOLI 180 339 1.12e-47 SMART
low complexity region 374 384 N/A INTRINSIC
low complexity region 417 436 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcription factor involved in the development of the pancreas, liver, kidney, and intestines. The encoded protein also functions to maintain glucose homeostasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Nullizygous embryos show delayed growth and lethality, impaired gastrulation, abnormal primitive streak and mesoderm formation, ectoderm apoptosis, and extraembryonic tissue dysplasia. Mice expressing only the alpha1 isoform show glucose intolerance whereas mice expressing alpha7 show dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T A 11: 53,368,695 M11K possibly damaging Het
Ank2 T C 3: 126,928,675 D88G probably damaging Het
Arhgap32 A G 9: 32,259,431 E1169G probably benign Het
Atp7b A T 8: 22,006,387 V865E probably damaging Het
Bcl2l13 T A 6: 120,848,543 Y13* probably null Het
Birc6 A G 17: 74,579,756 Q693R possibly damaging Het
Bub1 T C 2: 127,813,850 D520G probably damaging Het
Ccdc15 A T 9: 37,277,477 Y770* probably null Het
Cenpf T C 1: 189,654,263 E1940G probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cmya5 A G 13: 93,097,317 V421A probably benign Het
Cnnm1 A T 19: 43,471,913 Y698F possibly damaging Het
Cnst C T 1: 179,610,392 T507I probably benign Het
Coq8a T C 1: 180,182,229 M4V probably benign Het
Csmd3 A G 15: 48,622,089 L140P probably damaging Het
Cul2 A T 18: 3,426,851 I431F probably damaging Het
Dnah8 G T 17: 30,769,651 E3198D probably benign Het
Epn2 T A 11: 61,546,411 I112F possibly damaging Het
Ext2 T C 2: 93,730,225 E532G probably damaging Het
Fndc3a A T 14: 72,652,081 V37E probably damaging Het
Gabbr2 A G 4: 46,677,603 F759S possibly damaging Het
Ghr G A 15: 3,320,241 P485L probably benign Het
Glipr1l2 G T 10: 112,092,565 V122L probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm13128 T C 4: 144,333,005 S429P probably benign Het
Gm6871 G T 7: 41,546,452 T287K probably damaging Het
Gm7275 A G 16: 48,073,757 noncoding transcript Het
Hephl1 C T 9: 15,090,068 V254I probably damaging Het
Kcne3 C T 7: 100,184,424 R83C probably damaging Het
Klb C A 5: 65,375,861 N504K probably damaging Het
Loxl2 T A 14: 69,692,402 I743N possibly damaging Het
Lrrc9 A T 12: 72,456,117 L287F probably damaging Het
Mcm3ap C T 10: 76,484,674 P822L possibly damaging Het
Nacc2 T C 2: 26,060,143 N527S probably benign Het
Ncam1 G T 9: 49,557,145 P338H probably damaging Het
Nfkbiz G T 16: 55,816,394 Q515K possibly damaging Het
Nipsnap2 T C 5: 129,757,085 L263P probably damaging Het
Nlrp1a A T 11: 71,124,206 S73T probably benign Het
Nomo1 G A 7: 46,070,037 probably null Het
Nos3 G A 5: 24,377,312 G594D probably benign Het
Olfr1330 A G 4: 118,893,526 T148A probably benign Het
Olfr1359 A G 13: 21,703,450 I150V probably benign Het
Olfr148 A T 9: 39,613,620 T18S possibly damaging Het
Oprm1 A G 10: 6,830,105 I256V probably damaging Het
Oxct2a A T 4: 123,323,516 L24Q possibly damaging Het
Pcdhb14 T G 18: 37,448,178 S112R probably benign Het
Polr2a A G 11: 69,739,503 I1246T probably damaging Het
Ppil4 A T 10: 7,807,381 K327N probably damaging Het
Pstpip1 T C 9: 56,125,930 Y249H probably damaging Het
Qrsl1 A T 10: 43,881,515 V369E probably damaging Het
Ranbp10 G T 8: 105,779,978 P237T probably damaging Het
Rapgef6 A G 11: 54,676,284 N1097S probably damaging Het
Repin1 T A 6: 48,597,750 S538T probably damaging Het
Rims2 A T 15: 39,679,650 M1151L probably benign Het
Rin3 T A 12: 102,390,096 D965E possibly damaging Het
Sdc2 A G 15: 33,028,078 D114G probably benign Het
Slc25a30 C A 14: 75,775,083 A42S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssh2 T A 11: 77,437,756 F383I probably damaging Het
St8sia1 A T 6: 142,829,016 V279E probably damaging Het
Tacc2 C A 7: 130,626,598 S1690* probably null Het
Taf1b A G 12: 24,547,178 D372G possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem165 G T 5: 76,207,826 G272C probably damaging Het
Tsc22d2 TCAGTTAACACCTATGAACAGT TCAGT 3: 58,417,539 probably null Het
Tssk4 C A 14: 55,651,031 A119D probably damaging Het
Usp9y A G Y: 1,316,727 Y1941H probably damaging Het
Vmn2r42 A T 7: 8,184,265 M786K probably benign Het
Wdfy3 G T 5: 101,844,065 T3470K probably benign Het
Wdr63 C A 3: 146,097,262 R58L possibly damaging Het
Zc3h14 T C 12: 98,779,189 V479A probably benign Het
Zfp821 G A 8: 109,724,164 R263Q probably damaging Het
Other mutations in Hnf4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Hnf4a APN 2 163551572 splice site probably benign
IGL02077:Hnf4a APN 2 163562607 critical splice donor site probably null
IGL02419:Hnf4a APN 2 163566282 missense probably damaging 1.00
IGL02931:Hnf4a APN 2 163566117 splice site probably benign
R0230:Hnf4a UTSW 2 163559085 missense probably damaging 1.00
R1670:Hnf4a UTSW 2 163562576 missense probably damaging 1.00
R2131:Hnf4a UTSW 2 163547418 missense probably benign 0.10
R2509:Hnf4a UTSW 2 163566241 missense probably damaging 1.00
R4209:Hnf4a UTSW 2 163568889 missense probably benign 0.00
R4737:Hnf4a UTSW 2 163564219 missense probably benign 0.05
R5478:Hnf4a UTSW 2 163569006 missense probably benign
R6382:Hnf4a UTSW 2 163569006 missense probably benign
R7016:Hnf4a UTSW 2 163564273 missense probably damaging 1.00
R7443:Hnf4a UTSW 2 163559012 missense probably benign 0.03
R7875:Hnf4a UTSW 2 163559060 nonsense probably null
R7958:Hnf4a UTSW 2 163559060 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCCTGGAGGATTACATCAACGAC -3'
(R):5'- AGACCCTCAGCGTCTGAACAAATG -3'

Sequencing Primer
(F):5'- ACCGGCAGTACGACTCTC -3'
(R):5'- TCAGATGCAGCTGAAGTCTG -3'
Posted On2014-05-23