Mutagenetix > Incidental Mutations

Incidental Mutation 'R1743:Nos3'

200489

Institutional Source

Beutler Lab

Gene Symbol

Nos3

Ensembl Gene

ENSMUSG00000028978

Gene Name

nitric oxide synthase 3, endothelial cell

Synonyms

eNOS, 2310065A03Rik, ecNOS, Nos-3

MMRRC Submission

039775-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1743 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24364810-24384474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24377312 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 594 (G594D)

Ref Sequence

ENSEMBL: ENSMUSP00000110742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000115090]

Predicted Effect

probably benign
Transcript: ENSMUST00000030834
AA Change: G594D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978
AA Change: G594D

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
Pfam:NO_synthase	118	480	1.7e-183	PFAM
Pfam:Flavodoxin_1	521	697	4.8e-54	PFAM
Pfam:FAD_binding_1	750	978	2.1e-82	PFAM
Pfam:NAD_binding_1	1010	1124	1.9e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115090
AA Change: G594D

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978
AA Change: G594D

Domain	Start	End	E-Value	Type
low complexity region	11	27	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
Pfam:NO_synthase	114	485	9e-214	PFAM
Pfam:Flavodoxin_1	521	697	3.8e-54	PFAM
Pfam:FAD_binding_1	750	978	1.6e-79	PFAM
Pfam:NAD_binding_1	1010	1091	5.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156403

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff4	T	A	11: 53,368,695	M11K	possibly damaging	Het
Ank2	T	C	3: 126,928,675	D88G	probably damaging	Het
Arhgap32	A	G	9: 32,259,431	E1169G	probably benign	Het
Atp7b	A	T	8: 22,006,387	V865E	probably damaging	Het
Bcl2l13	T	A	6: 120,848,543	Y13*	probably null	Het
Birc6	A	G	17: 74,579,756	Q693R	possibly damaging	Het
Bub1	T	C	2: 127,813,850	D520G	probably damaging	Het
Ccdc15	A	T	9: 37,277,477	Y770*	probably null	Het
Cenpf	T	C	1: 189,654,263	E1940G	probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cmya5	A	G	13: 93,097,317	V421A	probably benign	Het
Cnnm1	A	T	19: 43,471,913	Y698F	possibly damaging	Het
Cnst	C	T	1: 179,610,392	T507I	probably benign	Het
Coq8a	T	C	1: 180,182,229	M4V	probably benign	Het
Csmd3	A	G	15: 48,622,089	L140P	probably damaging	Het
Cul2	A	T	18: 3,426,851	I431F	probably damaging	Het
Dnah8	G	T	17: 30,769,651	E3198D	probably benign	Het
Epn2	T	A	11: 61,546,411	I112F	possibly damaging	Het
Ext2	T	C	2: 93,730,225	E532G	probably damaging	Het
Fndc3a	A	T	14: 72,652,081	V37E	probably damaging	Het
Gabbr2	A	G	4: 46,677,603	F759S	possibly damaging	Het
Ghr	G	A	15: 3,320,241	P485L	probably benign	Het
Glipr1l2	G	T	10: 112,092,565	V122L	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm13128	T	C	4: 144,333,005	S429P	probably benign	Het
Gm6871	G	T	7: 41,546,452	T287K	probably damaging	Het
Gm7275	A	G	16: 48,073,757		noncoding transcript	Het
Hephl1	C	T	9: 15,090,068	V254I	probably damaging	Het
Hnf4a	C	A	2: 163,566,339	Q362K	possibly damaging	Het
Kcne3	C	T	7: 100,184,424	R83C	probably damaging	Het
Klb	C	A	5: 65,375,861	N504K	probably damaging	Het
Loxl2	T	A	14: 69,692,402	I743N	possibly damaging	Het
Lrrc9	A	T	12: 72,456,117	L287F	probably damaging	Het
Mcm3ap	C	T	10: 76,484,674	P822L	possibly damaging	Het
Nacc2	T	C	2: 26,060,143	N527S	probably benign	Het
Ncam1	G	T	9: 49,557,145	P338H	probably damaging	Het
Nfkbiz	G	T	16: 55,816,394	Q515K	possibly damaging	Het
Nipsnap2	T	C	5: 129,757,085	L263P	probably damaging	Het
Nlrp1a	A	T	11: 71,124,206	S73T	probably benign	Het
Nomo1	G	A	7: 46,070,037		probably null	Het
Olfr1330	A	G	4: 118,893,526	T148A	probably benign	Het
Olfr1359	A	G	13: 21,703,450	I150V	probably benign	Het
Olfr148	A	T	9: 39,613,620	T18S	possibly damaging	Het
Oprm1	A	G	10: 6,830,105	I256V	probably damaging	Het
Oxct2a	A	T	4: 123,323,516	L24Q	possibly damaging	Het
Pcdhb14	T	G	18: 37,448,178	S112R	probably benign	Het
Polr2a	A	G	11: 69,739,503	I1246T	probably damaging	Het
Ppil4	A	T	10: 7,807,381	K327N	probably damaging	Het
Pstpip1	T	C	9: 56,125,930	Y249H	probably damaging	Het
Qrsl1	A	T	10: 43,881,515	V369E	probably damaging	Het
Ranbp10	G	T	8: 105,779,978	P237T	probably damaging	Het
Rapgef6	A	G	11: 54,676,284	N1097S	probably damaging	Het
Repin1	T	A	6: 48,597,750	S538T	probably damaging	Het
Rims2	A	T	15: 39,679,650	M1151L	probably benign	Het
Rin3	T	A	12: 102,390,096	D965E	possibly damaging	Het
Sdc2	A	G	15: 33,028,078	D114G	probably benign	Het
Slc25a30	C	A	14: 75,775,083	A42S	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssh2	T	A	11: 77,437,756	F383I	probably damaging	Het
St8sia1	A	T	6: 142,829,016	V279E	probably damaging	Het
Tacc2	C	A	7: 130,626,598	S1690*	probably null	Het
Taf1b	A	G	12: 24,547,178	D372G	possibly damaging	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tmem165	G	T	5: 76,207,826	G272C	probably damaging	Het
Tsc22d2	TCAGTTAACACCTATGAACAGT	TCAGT	3: 58,417,539		probably null	Het
Tssk4	C	A	14: 55,651,031	A119D	probably damaging	Het
Usp9y	A	G	Y: 1,316,727	Y1941H	probably damaging	Het
Vmn2r42	A	T	7: 8,184,265	M786K	probably benign	Het
Wdfy3	G	T	5: 101,844,065	T3470K	probably benign	Het
Wdr63	C	A	3: 146,097,262	R58L	possibly damaging	Het
Zc3h14	T	C	12: 98,779,189	V479A	probably benign	Het
Zfp821	G	A	8: 109,724,164	R263Q	probably damaging	Het

Other mutations in Nos3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00903:Nos3	APN	5	24369862	missense	probably damaging	1.00
IGL02059:Nos3	APN	5	24368998	missense	probably damaging	1.00
IGL02354:Nos3	APN	5	24367623	missense	probably damaging	1.00
IGL02361:Nos3	APN	5	24367623	missense	probably damaging	1.00
IGL02936:Nos3	APN	5	24380993	missense	probably damaging	0.97
IGL03190:Nos3	APN	5	24383629	missense	probably damaging	1.00
paul	UTSW	5	24372704	missense	probably damaging	1.00
Peter	UTSW	5	24377855	missense	probably damaging	0.99
R0111:Nos3	UTSW	5	24372704	missense	probably damaging	1.00
R0387:Nos3	UTSW	5	24367585	missense	probably damaging	1.00
R0755:Nos3	UTSW	5	24367297	missense	probably damaging	1.00
R1156:Nos3	UTSW	5	24377619	missense	probably benign	0.21
R1597:Nos3	UTSW	5	24368997	missense	probably damaging	1.00
R1671:Nos3	UTSW	5	24383840	missense	probably damaging	1.00
R1830:Nos3	UTSW	5	24370133	missense	probably damaging	1.00
R1882:Nos3	UTSW	5	24368820	missense	probably damaging	1.00
R2294:Nos3	UTSW	5	24364857	missense	probably damaging	0.99
R3114:Nos3	UTSW	5	24372631	splice site	probably benign
R3978:Nos3	UTSW	5	24377931	missense	probably damaging	1.00
R3980:Nos3	UTSW	5	24377931	missense	probably damaging	1.00
R4016:Nos3	UTSW	5	24371716	missense	probably damaging	1.00
R4905:Nos3	UTSW	5	24367331	missense	probably benign	0.01
R4947:Nos3	UTSW	5	24377855	missense	probably damaging	0.99
R5017:Nos3	UTSW	5	24366719	intron	probably benign
R5095:Nos3	UTSW	5	24368918	splice site	probably benign
R5096:Nos3	UTSW	5	24371957	missense	probably damaging	1.00
R5102:Nos3	UTSW	5	24371627	missense	probably damaging	1.00
R5311:Nos3	UTSW	5	24377345	missense	probably benign	0.19
R5330:Nos3	UTSW	5	24369904	missense	probably damaging	1.00
R5367:Nos3	UTSW	5	24371944	missense	probably benign	0.00
R5394:Nos3	UTSW	5	24383890	missense	probably benign	0.00
R5574:Nos3	UTSW	5	24368861	missense	possibly damaging	0.80
R5889:Nos3	UTSW	5	24368777	intron	probably benign
R6032:Nos3	UTSW	5	24379811	missense	probably benign
R6032:Nos3	UTSW	5	24379811	missense	probably benign
R6401:Nos3	UTSW	5	24379811	missense	probably benign
R6517:Nos3	UTSW	5	24383624	missense	probably damaging	1.00
R6888:Nos3	UTSW	5	24383335	missense	possibly damaging	0.86
R6972:Nos3	UTSW	5	24380243	missense	probably benign
R6973:Nos3	UTSW	5	24380243	missense	probably benign
R7432:Nos3	UTSW	5	24367615	missense	probably damaging	0.98
R7434:Nos3	UTSW	5	24382635	missense	probably damaging	0.99
R7507:Nos3	UTSW	5	24372644	missense	probably damaging	1.00
R7553:Nos3	UTSW	5	24381717	missense	possibly damaging	0.62
R7652:Nos3	UTSW	5	24383612	missense	probably damaging	1.00
R8094:Nos3	UTSW	5	24367220	missense	probably benign	0.13
X0020:Nos3	UTSW	5	24370124	missense	probably damaging	1.00
X0061:Nos3	UTSW	5	24382635	missense	probably damaging	0.99
Z1176:Nos3	UTSW	5	24377654	missense	probably benign	0.02
Z1177:Nos3	UTSW	5	24383950	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTGTCCAAACCAGAATCAAGCTCC -3'
(R):5'- TGTCACAAGGAACTGACTGGGAAAC -3'

Sequencing Primer
(F):5'- acacacacacacatacacaaac -3'
(R):5'- CCCAGCCAGGGAATAGTTTTG -3'

Posted On

2014-05-23