Incidental Mutation 'R1743:Nos3'
ID200489
Institutional Source Beutler Lab
Gene Symbol Nos3
Ensembl Gene ENSMUSG00000028978
Gene Namenitric oxide synthase 3, endothelial cell
SynonymseNOS, 2310065A03Rik, ecNOS, Nos-3
MMRRC Submission 039775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1743 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24364810-24384474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24377312 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 594 (G594D)
Ref Sequence ENSEMBL: ENSMUSP00000110742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000115090]
Predicted Effect probably benign
Transcript: ENSMUST00000030834
AA Change: G594D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978
AA Change: G594D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115090
AA Change: G594D

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978
AA Change: G594D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156403
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T A 11: 53,368,695 M11K possibly damaging Het
Ank2 T C 3: 126,928,675 D88G probably damaging Het
Arhgap32 A G 9: 32,259,431 E1169G probably benign Het
Atp7b A T 8: 22,006,387 V865E probably damaging Het
Bcl2l13 T A 6: 120,848,543 Y13* probably null Het
Birc6 A G 17: 74,579,756 Q693R possibly damaging Het
Bub1 T C 2: 127,813,850 D520G probably damaging Het
Ccdc15 A T 9: 37,277,477 Y770* probably null Het
Cenpf T C 1: 189,654,263 E1940G probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cmya5 A G 13: 93,097,317 V421A probably benign Het
Cnnm1 A T 19: 43,471,913 Y698F possibly damaging Het
Cnst C T 1: 179,610,392 T507I probably benign Het
Coq8a T C 1: 180,182,229 M4V probably benign Het
Csmd3 A G 15: 48,622,089 L140P probably damaging Het
Cul2 A T 18: 3,426,851 I431F probably damaging Het
Dnah8 G T 17: 30,769,651 E3198D probably benign Het
Epn2 T A 11: 61,546,411 I112F possibly damaging Het
Ext2 T C 2: 93,730,225 E532G probably damaging Het
Fndc3a A T 14: 72,652,081 V37E probably damaging Het
Gabbr2 A G 4: 46,677,603 F759S possibly damaging Het
Ghr G A 15: 3,320,241 P485L probably benign Het
Glipr1l2 G T 10: 112,092,565 V122L probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm13128 T C 4: 144,333,005 S429P probably benign Het
Gm6871 G T 7: 41,546,452 T287K probably damaging Het
Gm7275 A G 16: 48,073,757 noncoding transcript Het
Hephl1 C T 9: 15,090,068 V254I probably damaging Het
Hnf4a C A 2: 163,566,339 Q362K possibly damaging Het
Kcne3 C T 7: 100,184,424 R83C probably damaging Het
Klb C A 5: 65,375,861 N504K probably damaging Het
Loxl2 T A 14: 69,692,402 I743N possibly damaging Het
Lrrc9 A T 12: 72,456,117 L287F probably damaging Het
Mcm3ap C T 10: 76,484,674 P822L possibly damaging Het
Nacc2 T C 2: 26,060,143 N527S probably benign Het
Ncam1 G T 9: 49,557,145 P338H probably damaging Het
Nfkbiz G T 16: 55,816,394 Q515K possibly damaging Het
Nipsnap2 T C 5: 129,757,085 L263P probably damaging Het
Nlrp1a A T 11: 71,124,206 S73T probably benign Het
Nomo1 G A 7: 46,070,037 probably null Het
Olfr1330 A G 4: 118,893,526 T148A probably benign Het
Olfr1359 A G 13: 21,703,450 I150V probably benign Het
Olfr148 A T 9: 39,613,620 T18S possibly damaging Het
Oprm1 A G 10: 6,830,105 I256V probably damaging Het
Oxct2a A T 4: 123,323,516 L24Q possibly damaging Het
Pcdhb14 T G 18: 37,448,178 S112R probably benign Het
Polr2a A G 11: 69,739,503 I1246T probably damaging Het
Ppil4 A T 10: 7,807,381 K327N probably damaging Het
Pstpip1 T C 9: 56,125,930 Y249H probably damaging Het
Qrsl1 A T 10: 43,881,515 V369E probably damaging Het
Ranbp10 G T 8: 105,779,978 P237T probably damaging Het
Rapgef6 A G 11: 54,676,284 N1097S probably damaging Het
Repin1 T A 6: 48,597,750 S538T probably damaging Het
Rims2 A T 15: 39,679,650 M1151L probably benign Het
Rin3 T A 12: 102,390,096 D965E possibly damaging Het
Sdc2 A G 15: 33,028,078 D114G probably benign Het
Slc25a30 C A 14: 75,775,083 A42S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssh2 T A 11: 77,437,756 F383I probably damaging Het
St8sia1 A T 6: 142,829,016 V279E probably damaging Het
Tacc2 C A 7: 130,626,598 S1690* probably null Het
Taf1b A G 12: 24,547,178 D372G possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem165 G T 5: 76,207,826 G272C probably damaging Het
Tsc22d2 TCAGTTAACACCTATGAACAGT TCAGT 3: 58,417,539 probably null Het
Tssk4 C A 14: 55,651,031 A119D probably damaging Het
Usp9y A G Y: 1,316,727 Y1941H probably damaging Het
Vmn2r42 A T 7: 8,184,265 M786K probably benign Het
Wdfy3 G T 5: 101,844,065 T3470K probably benign Het
Wdr63 C A 3: 146,097,262 R58L possibly damaging Het
Zc3h14 T C 12: 98,779,189 V479A probably benign Het
Zfp821 G A 8: 109,724,164 R263Q probably damaging Het
Other mutations in Nos3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Nos3 APN 5 24369862 missense probably damaging 1.00
IGL02059:Nos3 APN 5 24368998 missense probably damaging 1.00
IGL02354:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02361:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02936:Nos3 APN 5 24380993 missense probably damaging 0.97
IGL03190:Nos3 APN 5 24383629 missense probably damaging 1.00
paul UTSW 5 24372704 missense probably damaging 1.00
Peter UTSW 5 24377855 missense probably damaging 0.99
R0111:Nos3 UTSW 5 24372704 missense probably damaging 1.00
R0387:Nos3 UTSW 5 24367585 missense probably damaging 1.00
R0755:Nos3 UTSW 5 24367297 missense probably damaging 1.00
R1156:Nos3 UTSW 5 24377619 missense probably benign 0.21
R1597:Nos3 UTSW 5 24368997 missense probably damaging 1.00
R1671:Nos3 UTSW 5 24383840 missense probably damaging 1.00
R1830:Nos3 UTSW 5 24370133 missense probably damaging 1.00
R1882:Nos3 UTSW 5 24368820 missense probably damaging 1.00
R2294:Nos3 UTSW 5 24364857 missense probably damaging 0.99
R3114:Nos3 UTSW 5 24372631 splice site probably benign
R3978:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R3980:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R4016:Nos3 UTSW 5 24371716 missense probably damaging 1.00
R4905:Nos3 UTSW 5 24367331 missense probably benign 0.01
R4947:Nos3 UTSW 5 24377855 missense probably damaging 0.99
R5017:Nos3 UTSW 5 24366719 intron probably benign
R5095:Nos3 UTSW 5 24368918 splice site probably benign
R5096:Nos3 UTSW 5 24371957 missense probably damaging 1.00
R5102:Nos3 UTSW 5 24371627 missense probably damaging 1.00
R5311:Nos3 UTSW 5 24377345 missense probably benign 0.19
R5330:Nos3 UTSW 5 24369904 missense probably damaging 1.00
R5367:Nos3 UTSW 5 24371944 missense probably benign 0.00
R5394:Nos3 UTSW 5 24383890 missense probably benign 0.00
R5574:Nos3 UTSW 5 24368861 missense possibly damaging 0.80
R5889:Nos3 UTSW 5 24368777 intron probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6401:Nos3 UTSW 5 24379811 missense probably benign
R6517:Nos3 UTSW 5 24383624 missense probably damaging 1.00
R6888:Nos3 UTSW 5 24383335 missense possibly damaging 0.86
R6972:Nos3 UTSW 5 24380243 missense probably benign
R6973:Nos3 UTSW 5 24380243 missense probably benign
R7432:Nos3 UTSW 5 24367615 missense probably damaging 0.98
R7434:Nos3 UTSW 5 24382635 missense probably damaging 0.99
R7507:Nos3 UTSW 5 24372644 missense probably damaging 1.00
R7553:Nos3 UTSW 5 24381717 missense possibly damaging 0.62
R7652:Nos3 UTSW 5 24383612 missense probably damaging 1.00
X0020:Nos3 UTSW 5 24370124 missense probably damaging 1.00
X0061:Nos3 UTSW 5 24382635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTCCAAACCAGAATCAAGCTCC -3'
(R):5'- TGTCACAAGGAACTGACTGGGAAAC -3'

Sequencing Primer
(F):5'- acacacacacacatacacaaac -3'
(R):5'- CCCAGCCAGGGAATAGTTTTG -3'
Posted On2014-05-23