Mutagenetix > Incidental Mutations

Incidental Mutation 'R1743:Cep295'

200508

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

039775-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R1743 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 15340883 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 397 (E397K)

Ref Sequence

ENSEMBL: ENSMUSP00000096578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

probably damaging
Transcript: ENSMUST00000098979
AA Change: E397K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: E397K

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161132
AA Change: E397K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: E397K

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161795
AA Change: E349K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: E349K

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163010

Meta Mutation Damage Score

0.1905

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff4	T	A	11: 53,368,695	M11K	possibly damaging	Het
Ank2	T	C	3: 126,928,675	D88G	probably damaging	Het
Arhgap32	A	G	9: 32,259,431	E1169G	probably benign	Het
Atp7b	A	T	8: 22,006,387	V865E	probably damaging	Het
Bcl2l13	T	A	6: 120,848,543	Y13*	probably null	Het
Birc6	A	G	17: 74,579,756	Q693R	possibly damaging	Het
Bub1	T	C	2: 127,813,850	D520G	probably damaging	Het
Ccdc15	A	T	9: 37,277,477	Y770*	probably null	Het
Cenpf	T	C	1: 189,654,263	E1940G	probably benign	Het
Cmya5	A	G	13: 93,097,317	V421A	probably benign	Het
Cnnm1	A	T	19: 43,471,913	Y698F	possibly damaging	Het
Cnst	C	T	1: 179,610,392	T507I	probably benign	Het
Coq8a	T	C	1: 180,182,229	M4V	probably benign	Het
Csmd3	A	G	15: 48,622,089	L140P	probably damaging	Het
Cul2	A	T	18: 3,426,851	I431F	probably damaging	Het
Dnah8	G	T	17: 30,769,651	E3198D	probably benign	Het
Epn2	T	A	11: 61,546,411	I112F	possibly damaging	Het
Ext2	T	C	2: 93,730,225	E532G	probably damaging	Het
Fndc3a	A	T	14: 72,652,081	V37E	probably damaging	Het
Gabbr2	A	G	4: 46,677,603	F759S	possibly damaging	Het
Ghr	G	A	15: 3,320,241	P485L	probably benign	Het
Glipr1l2	G	T	10: 112,092,565	V122L	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm13128	T	C	4: 144,333,005	S429P	probably benign	Het
Gm6871	G	T	7: 41,546,452	T287K	probably damaging	Het
Gm7275	A	G	16: 48,073,757		noncoding transcript	Het
Hephl1	C	T	9: 15,090,068	V254I	probably damaging	Het
Hnf4a	C	A	2: 163,566,339	Q362K	possibly damaging	Het
Kcne3	C	T	7: 100,184,424	R83C	probably damaging	Het
Klb	C	A	5: 65,375,861	N504K	probably damaging	Het
Loxl2	T	A	14: 69,692,402	I743N	possibly damaging	Het
Lrrc9	A	T	12: 72,456,117	L287F	probably damaging	Het
Mcm3ap	C	T	10: 76,484,674	P822L	possibly damaging	Het
Nacc2	T	C	2: 26,060,143	N527S	probably benign	Het
Ncam1	G	T	9: 49,557,145	P338H	probably damaging	Het
Nfkbiz	G	T	16: 55,816,394	Q515K	possibly damaging	Het
Nipsnap2	T	C	5: 129,757,085	L263P	probably damaging	Het
Nlrp1a	A	T	11: 71,124,206	S73T	probably benign	Het
Nomo1	G	A	7: 46,070,037		probably null	Het
Nos3	G	A	5: 24,377,312	G594D	probably benign	Het
Olfr1330	A	G	4: 118,893,526	T148A	probably benign	Het
Olfr1359	A	G	13: 21,703,450	I150V	probably benign	Het
Olfr148	A	T	9: 39,613,620	T18S	possibly damaging	Het
Oprm1	A	G	10: 6,830,105	I256V	probably damaging	Het
Oxct2a	A	T	4: 123,323,516	L24Q	possibly damaging	Het
Pcdhb14	T	G	18: 37,448,178	S112R	probably benign	Het
Polr2a	A	G	11: 69,739,503	I1246T	probably damaging	Het
Ppil4	A	T	10: 7,807,381	K327N	probably damaging	Het
Pstpip1	T	C	9: 56,125,930	Y249H	probably damaging	Het
Qrsl1	A	T	10: 43,881,515	V369E	probably damaging	Het
Ranbp10	G	T	8: 105,779,978	P237T	probably damaging	Het
Rapgef6	A	G	11: 54,676,284	N1097S	probably damaging	Het
Repin1	T	A	6: 48,597,750	S538T	probably damaging	Het
Rims2	A	T	15: 39,679,650	M1151L	probably benign	Het
Rin3	T	A	12: 102,390,096	D965E	possibly damaging	Het
Sdc2	A	G	15: 33,028,078	D114G	probably benign	Het
Slc25a30	C	A	14: 75,775,083	A42S	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssh2	T	A	11: 77,437,756	F383I	probably damaging	Het
St8sia1	A	T	6: 142,829,016	V279E	probably damaging	Het
Tacc2	C	A	7: 130,626,598	S1690*	probably null	Het
Taf1b	A	G	12: 24,547,178	D372G	possibly damaging	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tmem165	G	T	5: 76,207,826	G272C	probably damaging	Het
Tsc22d2	TCAGTTAACACCTATGAACAGT	TCAGT	3: 58,417,539		probably null	Het
Tssk4	C	A	14: 55,651,031	A119D	probably damaging	Het
Usp9y	A	G	Y: 1,316,727	Y1941H	probably damaging	Het
Vmn2r42	A	T	7: 8,184,265	M786K	probably benign	Het
Wdfy3	G	T	5: 101,844,065	T3470K	probably benign	Het
Wdr63	C	A	3: 146,097,262	R58L	possibly damaging	Het
Zc3h14	T	C	12: 98,779,189	V479A	probably benign	Het
Zfp821	G	A	8: 109,724,164	R263Q	probably damaging	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	unclassified	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	unclassified	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- GGACCTGATCTCCAATGGCAGAAAC -3'
(R):5'- AGGGACTGTCACCAGTGCTTTTAAATG -3'

Sequencing Primer
(F):5'- CAGACATGCAGAGTAGCAATGC -3'
(R):5'- agccatctcaccagccc -3'

Posted On

2014-05-23