Incidental Mutation 'R1743:Aff4'
ID 200521
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission 039775-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1743 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 53241660-53312657 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53259522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 11 (M11K)
Ref Sequence ENSEMBL: ENSMUSP00000120613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945] [ENSMUST00000153821]
AlphaFold Q9ESC8
Predicted Effect possibly damaging
Transcript: ENSMUST00000060945
AA Change: M11K

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: M11K

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139054
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153821
AA Change: M11K

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120613
Gene: ENSMUSG00000049470
AA Change: M11K

DomainStartEndE-ValueType
Pfam:AF-4 2 122 4.1e-60 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 T C 3: 126,722,324 (GRCm39) D88G probably damaging Het
Arhgap32 A G 9: 32,170,727 (GRCm39) E1169G probably benign Het
Atp7b A T 8: 22,496,403 (GRCm39) V865E probably damaging Het
Bcl2l13 T A 6: 120,825,504 (GRCm39) Y13* probably null Het
Birc6 A G 17: 74,886,751 (GRCm39) Q693R possibly damaging Het
Bub1 T C 2: 127,655,770 (GRCm39) D520G probably damaging Het
Ccdc15 A T 9: 37,188,773 (GRCm39) Y770* probably null Het
Cenpf T C 1: 189,386,460 (GRCm39) E1940G probably benign Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Cmya5 A G 13: 93,233,825 (GRCm39) V421A probably benign Het
Cnnm1 A T 19: 43,460,352 (GRCm39) Y698F possibly damaging Het
Cnst C T 1: 179,437,957 (GRCm39) T507I probably benign Het
Coq8a T C 1: 180,009,794 (GRCm39) M4V probably benign Het
Csmd3 A G 15: 48,485,485 (GRCm39) L140P probably damaging Het
Cul2 A T 18: 3,426,851 (GRCm39) I431F probably damaging Het
Dnah8 G T 17: 30,988,625 (GRCm39) E3198D probably benign Het
Dnai3 C A 3: 145,803,017 (GRCm39) R58L possibly damaging Het
Epn2 T A 11: 61,437,237 (GRCm39) I112F possibly damaging Het
Ext2 T C 2: 93,560,570 (GRCm39) E532G probably damaging Het
Fndc3a A T 14: 72,889,521 (GRCm39) V37E probably damaging Het
Gabbr2 A G 4: 46,677,603 (GRCm39) F759S possibly damaging Het
Ghr G A 15: 3,349,723 (GRCm39) P485L probably benign Het
Glipr1l2 G T 10: 111,928,470 (GRCm39) V122L probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably benign Het
Gm6871 G T 7: 41,195,876 (GRCm39) T287K probably damaging Het
Gm7275 A G 16: 47,894,120 (GRCm39) noncoding transcript Het
Hephl1 C T 9: 15,001,364 (GRCm39) V254I probably damaging Het
Hnf4a C A 2: 163,408,259 (GRCm39) Q362K possibly damaging Het
Kcne3 C T 7: 99,833,631 (GRCm39) R83C probably damaging Het
Klb C A 5: 65,533,204 (GRCm39) N504K probably damaging Het
Loxl2 T A 14: 69,929,851 (GRCm39) I743N possibly damaging Het
Lrrc9 A T 12: 72,502,891 (GRCm39) L287F probably damaging Het
Mcm3ap C T 10: 76,320,508 (GRCm39) P822L possibly damaging Het
Nacc2 T C 2: 25,950,155 (GRCm39) N527S probably benign Het
Ncam1 G T 9: 49,468,445 (GRCm39) P338H probably damaging Het
Nfkbiz G T 16: 55,636,757 (GRCm39) Q515K possibly damaging Het
Nipsnap2 T C 5: 129,834,149 (GRCm39) L263P probably damaging Het
Nlrp1a A T 11: 71,015,032 (GRCm39) S73T probably benign Het
Nomo1 G A 7: 45,719,461 (GRCm39) probably null Het
Nos3 G A 5: 24,582,310 (GRCm39) G594D probably benign Het
Oprm1 A G 10: 6,780,105 (GRCm39) I256V probably damaging Het
Or10ak16 A G 4: 118,750,723 (GRCm39) T148A probably benign Het
Or10n1 A T 9: 39,524,916 (GRCm39) T18S possibly damaging Het
Or2b2 A G 13: 21,887,620 (GRCm39) I150V probably benign Het
Oxct2a A T 4: 123,217,309 (GRCm39) L24Q possibly damaging Het
Pcdhb14 T G 18: 37,581,231 (GRCm39) S112R probably benign Het
Polr2a A G 11: 69,630,329 (GRCm39) I1246T probably damaging Het
Ppil4 A T 10: 7,683,145 (GRCm39) K327N probably damaging Het
Pramel30 T C 4: 144,059,575 (GRCm39) S429P probably benign Het
Pstpip1 T C 9: 56,033,214 (GRCm39) Y249H probably damaging Het
Qrsl1 A T 10: 43,757,511 (GRCm39) V369E probably damaging Het
Ranbp10 G T 8: 106,506,610 (GRCm39) P237T probably damaging Het
Rapgef6 A G 11: 54,567,110 (GRCm39) N1097S probably damaging Het
Repin1 T A 6: 48,574,684 (GRCm39) S538T probably damaging Het
Rims2 A T 15: 39,543,046 (GRCm39) M1151L probably benign Het
Rin3 T A 12: 102,356,355 (GRCm39) D965E possibly damaging Het
Sdc2 A G 15: 33,028,224 (GRCm39) D114G probably benign Het
Slc25a30 C A 14: 76,012,523 (GRCm39) A42S probably benign Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Ssh2 T A 11: 77,328,582 (GRCm39) F383I probably damaging Het
St8sia1 A T 6: 142,774,742 (GRCm39) V279E probably damaging Het
Tacc2 C A 7: 130,228,328 (GRCm39) S1690* probably null Het
Taf1b A G 12: 24,597,177 (GRCm39) D372G possibly damaging Het
Timm21 G C 18: 84,967,387 (GRCm39) L130V probably damaging Het
Tmem165 G T 5: 76,355,673 (GRCm39) G272C probably damaging Het
Tsc22d2 TCAGTTAACACCTATGAACAGT TCAGT 3: 58,324,960 (GRCm39) probably null Het
Tssk4 C A 14: 55,888,488 (GRCm39) A119D probably damaging Het
Usp9y A G Y: 1,316,727 (GRCm39) Y1941H probably damaging Het
Vmn2r42 A T 7: 8,187,264 (GRCm39) M786K probably benign Het
Wdfy3 G T 5: 101,991,931 (GRCm39) T3470K probably benign Het
Zc3h14 T C 12: 98,745,448 (GRCm39) V479A probably benign Het
Zfp821 G A 8: 110,450,796 (GRCm39) R263Q probably damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53,302,817 (GRCm39) missense probably damaging 0.98
IGL01348:Aff4 APN 11 53,293,327 (GRCm39) missense probably benign
IGL01446:Aff4 APN 11 53,306,296 (GRCm39) missense probably damaging 0.99
IGL02151:Aff4 APN 11 53,290,633 (GRCm39) missense probably benign
IGL02526:Aff4 APN 11 53,297,509 (GRCm39) splice site probably benign
IGL02567:Aff4 APN 11 53,263,578 (GRCm39) missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53,300,198 (GRCm39) splice site probably benign
IGL02707:Aff4 APN 11 53,290,567 (GRCm39) missense probably benign
R0090:Aff4 UTSW 11 53,283,609 (GRCm39) missense probably benign 0.01
R0128:Aff4 UTSW 11 53,306,293 (GRCm39) missense probably damaging 0.99
R0243:Aff4 UTSW 11 53,288,685 (GRCm39) missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53,263,708 (GRCm39) missense probably benign 0.00
R0347:Aff4 UTSW 11 53,290,915 (GRCm39) missense probably benign 0.01
R0732:Aff4 UTSW 11 53,266,423 (GRCm39) missense probably benign
R0737:Aff4 UTSW 11 53,301,780 (GRCm39) nonsense probably null
R1464:Aff4 UTSW 11 53,263,351 (GRCm39) missense probably damaging 0.97
R1464:Aff4 UTSW 11 53,263,351 (GRCm39) missense probably damaging 0.97
R1500:Aff4 UTSW 11 53,263,205 (GRCm39) missense probably benign 0.00
R1693:Aff4 UTSW 11 53,287,380 (GRCm39) missense probably damaging 1.00
R1961:Aff4 UTSW 11 53,263,826 (GRCm39) missense probably damaging 1.00
R2048:Aff4 UTSW 11 53,289,212 (GRCm39) missense probably benign 0.39
R2138:Aff4 UTSW 11 53,263,339 (GRCm39) missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53,290,446 (GRCm39) missense probably damaging 1.00
R2379:Aff4 UTSW 11 53,299,305 (GRCm39) splice site probably benign
R4156:Aff4 UTSW 11 53,301,726 (GRCm39) intron probably benign
R5001:Aff4 UTSW 11 53,295,184 (GRCm39) missense probably damaging 1.00
R5281:Aff4 UTSW 11 53,263,115 (GRCm39) missense probably damaging 1.00
R5477:Aff4 UTSW 11 53,299,299 (GRCm39) critical splice donor site probably null
R5677:Aff4 UTSW 11 53,291,102 (GRCm39) missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53,263,837 (GRCm39) missense probably damaging 0.99
R6576:Aff4 UTSW 11 53,291,268 (GRCm39) missense probably damaging 1.00
R6764:Aff4 UTSW 11 53,290,657 (GRCm39) missense probably damaging 1.00
R6988:Aff4 UTSW 11 53,289,064 (GRCm39) missense probably damaging 1.00
R7034:Aff4 UTSW 11 53,299,236 (GRCm39) missense probably damaging 0.99
R7177:Aff4 UTSW 11 53,297,466 (GRCm39) missense probably benign 0.10
R7426:Aff4 UTSW 11 53,263,702 (GRCm39) missense probably damaging 1.00
R7755:Aff4 UTSW 11 53,289,206 (GRCm39) missense probably damaging 0.97
R7848:Aff4 UTSW 11 53,295,339 (GRCm39) missense probably benign 0.05
R7968:Aff4 UTSW 11 53,300,175 (GRCm39) missense probably damaging 1.00
R8159:Aff4 UTSW 11 53,302,721 (GRCm39) missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53,289,084 (GRCm39) missense probably damaging 0.98
R8241:Aff4 UTSW 11 53,290,998 (GRCm39) missense probably benign 0.00
R8284:Aff4 UTSW 11 53,295,379 (GRCm39) missense probably damaging 0.99
R8373:Aff4 UTSW 11 53,291,094 (GRCm39) nonsense probably null
R8695:Aff4 UTSW 11 53,259,509 (GRCm39) missense probably damaging 1.00
R8777:Aff4 UTSW 11 53,290,783 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53,290,783 (GRCm39) missense probably damaging 1.00
R8780:Aff4 UTSW 11 53,271,444 (GRCm39) missense probably damaging 1.00
R8798:Aff4 UTSW 11 53,291,335 (GRCm39) critical splice donor site probably benign
R8838:Aff4 UTSW 11 53,297,465 (GRCm39) missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53,263,231 (GRCm39) missense probably benign
R9146:Aff4 UTSW 11 53,298,963 (GRCm39) missense probably benign 0.06
R9329:Aff4 UTSW 11 53,288,686 (GRCm39) missense probably damaging 1.00
R9378:Aff4 UTSW 11 53,263,306 (GRCm39) missense probably damaging 0.98
R9471:Aff4 UTSW 11 53,271,473 (GRCm39) missense probably benign 0.13
R9779:Aff4 UTSW 11 53,263,734 (GRCm39) nonsense probably null
R9796:Aff4 UTSW 11 53,302,824 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTAGTGCCAGAATCCCATTTCAGC -3'
(R):5'- GGGAAACACAGCATCTGTGACTGTC -3'

Sequencing Primer
(F):5'- CATTTCAGCACTAACTAACACCTG -3'
(R):5'- aactccagattcagggcac -3'
Posted On 2014-05-23