Mutagenetix > Incidental Mutation

Incidental Mutation 'R1743:Cmya5'

200536

Institutional Source

Beutler Lab

Gene Symbol

Cmya5

Ensembl Gene

ENSMUSG00000047419

Gene Name

cardiomyopathy associated 5

Synonyms

Myospryn, 2310076E21Rik, 2310076E16Rik

MMRRC Submission

039775-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.326) question?

Stock #

R1743 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93040713-93144724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93097317 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 421 (V421A)

Ref Sequence

ENSEMBL: ENSMUSP00000050408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062122]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062122
AA Change: V421A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: V421A

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
low complexity region	129	140	N/A	INTRINSIC
internal_repeat_1	448	535	5.09e-18	PROSPERO
internal_repeat_1	543	625	5.09e-18	PROSPERO
low complexity region	626	645	N/A	INTRINSIC
low complexity region	679	691	N/A	INTRINSIC
low complexity region	734	741	N/A	INTRINSIC
low complexity region	1001	1010	N/A	INTRINSIC
low complexity region	1166	1183	N/A	INTRINSIC
low complexity region	1259	1267	N/A	INTRINSIC
low complexity region	1440	1449	N/A	INTRINSIC
low complexity region	1876	1889	N/A	INTRINSIC
low complexity region	2632	2645	N/A	INTRINSIC
low complexity region	3048	3057	N/A	INTRINSIC
FN3	3312	3399	7.29e-4	SMART
FN3	3411	3492	1.3e0	SMART
Pfam:SPRY	3551	3668	6.7e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224009

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff4	T	A	11: 53,368,695	M11K	possibly damaging	Het
Ank2	T	C	3: 126,928,675	D88G	probably damaging	Het
Arhgap32	A	G	9: 32,259,431	E1169G	probably benign	Het
Atp7b	A	T	8: 22,006,387	V865E	probably damaging	Het
Bcl2l13	T	A	6: 120,848,543	Y13*	probably null	Het
Birc6	A	G	17: 74,579,756	Q693R	possibly damaging	Het
Bub1	T	C	2: 127,813,850	D520G	probably damaging	Het
Ccdc15	A	T	9: 37,277,477	Y770*	probably null	Het
Cenpf	T	C	1: 189,654,263	E1940G	probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnnm1	A	T	19: 43,471,913	Y698F	possibly damaging	Het
Cnst	C	T	1: 179,610,392	T507I	probably benign	Het
Coq8a	T	C	1: 180,182,229	M4V	probably benign	Het
Csmd3	A	G	15: 48,622,089	L140P	probably damaging	Het
Cul2	A	T	18: 3,426,851	I431F	probably damaging	Het
Dnah8	G	T	17: 30,769,651	E3198D	probably benign	Het
Epn2	T	A	11: 61,546,411	I112F	possibly damaging	Het
Ext2	T	C	2: 93,730,225	E532G	probably damaging	Het
Fndc3a	A	T	14: 72,652,081	V37E	probably damaging	Het
Gabbr2	A	G	4: 46,677,603	F759S	possibly damaging	Het
Ghr	G	A	15: 3,320,241	P485L	probably benign	Het
Glipr1l2	G	T	10: 112,092,565	V122L	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gm13128	T	C	4: 144,333,005	S429P	probably benign	Het
Gm6871	G	T	7: 41,546,452	T287K	probably damaging	Het
Gm7275	A	G	16: 48,073,757		noncoding transcript	Het
Hephl1	C	T	9: 15,090,068	V254I	probably damaging	Het
Hnf4a	C	A	2: 163,566,339	Q362K	possibly damaging	Het
Kcne3	C	T	7: 100,184,424	R83C	probably damaging	Het
Klb	C	A	5: 65,375,861	N504K	probably damaging	Het
Loxl2	T	A	14: 69,692,402	I743N	possibly damaging	Het
Lrrc9	A	T	12: 72,456,117	L287F	probably damaging	Het
Mcm3ap	C	T	10: 76,484,674	P822L	possibly damaging	Het
Nacc2	T	C	2: 26,060,143	N527S	probably benign	Het
Ncam1	G	T	9: 49,557,145	P338H	probably damaging	Het
Nfkbiz	G	T	16: 55,816,394	Q515K	possibly damaging	Het
Nipsnap2	T	C	5: 129,757,085	L263P	probably damaging	Het
Nlrp1a	A	T	11: 71,124,206	S73T	probably benign	Het
Nomo1	G	A	7: 46,070,037		probably null	Het
Nos3	G	A	5: 24,377,312	G594D	probably benign	Het
Olfr1330	A	G	4: 118,893,526	T148A	probably benign	Het
Olfr1359	A	G	13: 21,703,450	I150V	probably benign	Het
Olfr148	A	T	9: 39,613,620	T18S	possibly damaging	Het
Oprm1	A	G	10: 6,830,105	I256V	probably damaging	Het
Oxct2a	A	T	4: 123,323,516	L24Q	possibly damaging	Het
Pcdhb14	T	G	18: 37,448,178	S112R	probably benign	Het
Polr2a	A	G	11: 69,739,503	I1246T	probably damaging	Het
Ppil4	A	T	10: 7,807,381	K327N	probably damaging	Het
Pstpip1	T	C	9: 56,125,930	Y249H	probably damaging	Het
Qrsl1	A	T	10: 43,881,515	V369E	probably damaging	Het
Ranbp10	G	T	8: 105,779,978	P237T	probably damaging	Het
Rapgef6	A	G	11: 54,676,284	N1097S	probably damaging	Het
Repin1	T	A	6: 48,597,750	S538T	probably damaging	Het
Rims2	A	T	15: 39,679,650	M1151L	probably benign	Het
Rin3	T	A	12: 102,390,096	D965E	possibly damaging	Het
Sdc2	A	G	15: 33,028,078	D114G	probably benign	Het
Slc25a30	C	A	14: 75,775,083	A42S	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssh2	T	A	11: 77,437,756	F383I	probably damaging	Het
St8sia1	A	T	6: 142,829,016	V279E	probably damaging	Het
Tacc2	C	A	7: 130,626,598	S1690*	probably null	Het
Taf1b	A	G	12: 24,547,178	D372G	possibly damaging	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tmem165	G	T	5: 76,207,826	G272C	probably damaging	Het
Tsc22d2	TCAGTTAACACCTATGAACAGT	TCAGT	3: 58,417,539		probably null	Het
Tssk4	C	A	14: 55,651,031	A119D	probably damaging	Het
Usp9y	A	G	Y: 1,316,727	Y1941H	probably damaging	Het
Vmn2r42	A	T	7: 8,184,265	M786K	probably benign	Het
Wdfy3	G	T	5: 101,844,065	T3470K	probably benign	Het
Wdr63	C	A	3: 146,097,262	R58L	possibly damaging	Het
Zc3h14	T	C	12: 98,779,189	V479A	probably benign	Het
Zfp821	G	A	8: 109,724,164	R263Q	probably damaging	Het

Other mutations in Cmya5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Cmya5	APN	13	93093120	missense	probably benign	0.13
IGL00516:Cmya5	APN	13	93098167	missense	possibly damaging	0.73
IGL00654:Cmya5	APN	13	93094161	missense	probably benign	0.00
IGL00948:Cmya5	APN	13	93091036	missense	probably benign
IGL00966:Cmya5	APN	13	93097906	missense	probably benign	0.33
IGL00988:Cmya5	APN	13	93097933	missense	possibly damaging	0.96
IGL01106:Cmya5	APN	13	93084612	missense	probably damaging	1.00
IGL01331:Cmya5	APN	13	93096946	missense	possibly damaging	0.53
IGL01392:Cmya5	APN	13	93089206	missense	probably damaging	0.99
IGL01508:Cmya5	APN	13	93094027	missense	probably benign
IGL01679:Cmya5	APN	13	93065320	missense	probably damaging	1.00
IGL01749:Cmya5	APN	13	93089299	missense	probably benign	0.00
IGL01861:Cmya5	APN	13	93089748	missense	probably damaging	1.00
IGL02021:Cmya5	APN	13	93094549	missense	probably benign	0.00
IGL02034:Cmya5	APN	13	93084535	splice site	probably benign
IGL02103:Cmya5	APN	13	93092127	missense	probably benign	0.05
IGL02174:Cmya5	APN	13	93048907	missense	possibly damaging	0.76
IGL02176:Cmya5	APN	13	93090150	missense	probably damaging	1.00
IGL02210:Cmya5	APN	13	93092734	missense	probably benign	0.14
IGL02229:Cmya5	APN	13	93092686	missense	possibly damaging	0.54
IGL02306:Cmya5	APN	13	93098019	missense	probably damaging	1.00
IGL02311:Cmya5	APN	13	93090655	missense	probably benign	0.40
IGL02409:Cmya5	APN	13	93090198	missense	probably damaging	0.96
IGL02561:Cmya5	APN	13	93091858	missense	probably benign	0.00
IGL02676:Cmya5	APN	13	93092853	missense	probably damaging	1.00
IGL02683:Cmya5	APN	13	93090997	nonsense	probably null
IGL02685:Cmya5	APN	13	93090997	nonsense	probably null
IGL02686:Cmya5	APN	13	93090997	nonsense	probably null
IGL02724:Cmya5	APN	13	93096655	missense	probably benign
IGL02727:Cmya5	APN	13	93098245	missense	possibly damaging	0.73
IGL02965:Cmya5	APN	13	93092557	missense	probably benign	0.41
IGL03079:Cmya5	APN	13	93097701	missense	possibly damaging	0.85
IGL03144:Cmya5	APN	13	93090868	missense	probably damaging	1.00
IGL03253:Cmya5	APN	13	93091270	nonsense	probably null
IGL03336:Cmya5	APN	13	93093505	missense	possibly damaging	0.84
IGL03138:Cmya5	UTSW	13	93065342	missense	probably damaging	1.00
P0023:Cmya5	UTSW	13	93089346	missense	probably benign	0.22
P4748:Cmya5	UTSW	13	93074475	splice site	probably benign
R0123:Cmya5	UTSW	13	93095904	missense	possibly damaging	0.84
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0331:Cmya5	UTSW	13	93144403	missense	possibly damaging	0.53
R0363:Cmya5	UTSW	13	93094869	missense	possibly damaging	0.77
R0382:Cmya5	UTSW	13	93092748	missense	probably benign	0.06
R0416:Cmya5	UTSW	13	93089856	missense	probably benign	0.05
R0446:Cmya5	UTSW	13	93093656	missense	probably benign
R0457:Cmya5	UTSW	13	93095587	missense	possibly damaging	0.84
R0673:Cmya5	UTSW	13	93089997	missense	probably damaging	1.00
R0674:Cmya5	UTSW	13	93092791	missense	probably damaging	1.00
R0692:Cmya5	UTSW	13	93093849	nonsense	probably null
R0698:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R1227:Cmya5	UTSW	13	93094446	missense	probably damaging	0.99
R1272:Cmya5	UTSW	13	93095112	missense	possibly damaging	0.79
R1335:Cmya5	UTSW	13	93041535	missense	possibly damaging	0.65
R1353:Cmya5	UTSW	13	93041525	missense	probably damaging	1.00
R1354:Cmya5	UTSW	13	93092058	missense	possibly damaging	0.46
R1458:Cmya5	UTSW	13	93065327	missense	probably benign	0.44
R1572:Cmya5	UTSW	13	93094269	missense	possibly damaging	0.61
R1698:Cmya5	UTSW	13	93063519	missense	probably benign	0.27
R1735:Cmya5	UTSW	13	93089789	missense	probably benign	0.11
R1750:Cmya5	UTSW	13	93095663	missense	probably benign
R1827:Cmya5	UTSW	13	93074448	missense	possibly damaging	0.80
R2068:Cmya5	UTSW	13	93090524	missense	possibly damaging	0.93
R2088:Cmya5	UTSW	13	93092812	missense	probably damaging	1.00
R2132:Cmya5	UTSW	13	93069383	missense	probably damaging	1.00
R2216:Cmya5	UTSW	13	93093495	missense	probably damaging	1.00
R2363:Cmya5	UTSW	13	93093702	missense	probably benign	0.15
R2497:Cmya5	UTSW	13	93098005	missense	possibly damaging	0.53
R2509:Cmya5	UTSW	13	93093558	missense	probably benign	0.41
R2917:Cmya5	UTSW	13	93091064	nonsense	probably null
R2944:Cmya5	UTSW	13	93092842	nonsense	probably null
R3039:Cmya5	UTSW	13	93092250	missense	probably benign	0.12
R3078:Cmya5	UTSW	13	93048927	missense	probably damaging	0.99
R3708:Cmya5	UTSW	13	93095366	nonsense	probably null
R3717:Cmya5	UTSW	13	93092487	missense	probably benign	0.12
R3768:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3769:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3840:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3841:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3882:Cmya5	UTSW	13	93091219	missense	probably benign	0.07
R3888:Cmya5	UTSW	13	93093656	missense	probably benign
R3897:Cmya5	UTSW	13	93096681	missense	possibly damaging	0.72
R3952:Cmya5	UTSW	13	93089199	missense	possibly damaging	0.89
R4366:Cmya5	UTSW	13	93091956	missense	probably benign	0.36
R4471:Cmya5	UTSW	13	93092325	missense	probably benign	0.01
R4493:Cmya5	UTSW	13	93094065	missense	probably benign
R4495:Cmya5	UTSW	13	93094065	missense	probably benign
R4544:Cmya5	UTSW	13	93091918	nonsense	probably null
R4545:Cmya5	UTSW	13	93091918	nonsense	probably null
R4624:Cmya5	UTSW	13	93063551	missense	probably damaging	1.00
R4648:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R4824:Cmya5	UTSW	13	93093574	missense	probably benign	0.04
R4965:Cmya5	UTSW	13	93095787	missense	possibly damaging	0.84
R4967:Cmya5	UTSW	13	93090585	missense	probably damaging	1.00
R5101:Cmya5	UTSW	13	93091603	missense	possibly damaging	0.61
R5133:Cmya5	UTSW	13	93093372	missense	possibly damaging	0.79
R5139:Cmya5	UTSW	13	93096061	missense	probably benign	0.00
R5220:Cmya5	UTSW	13	93092296	missense	probably damaging	0.99
R5332:Cmya5	UTSW	13	93096195	missense	probably damaging	0.96
R5337:Cmya5	UTSW	13	93083273	missense	probably benign	0.28
R5356:Cmya5	UTSW	13	93063485	missense	probably damaging	1.00
R5401:Cmya5	UTSW	13	93091968	missense	probably damaging	1.00
R5438:Cmya5	UTSW	13	93095199	missense	possibly damaging	0.89
R5604:Cmya5	UTSW	13	93092763	missense	probably benign	0.15
R5628:Cmya5	UTSW	13	93089710	missense	probably damaging	1.00
R5666:Cmya5	UTSW	13	93045949	missense	possibly damaging	0.75
R5687:Cmya5	UTSW	13	93098176	missense	possibly damaging	0.53
R5695:Cmya5	UTSW	13	93045866	critical splice donor site	probably null
R5806:Cmya5	UTSW	13	93093937	missense	possibly damaging	0.84
R5820:Cmya5	UTSW	13	93092780	missense	probably benign	0.04
R5872:Cmya5	UTSW	13	93097435	missense	probably benign	0.01
R5875:Cmya5	UTSW	13	93095184	missense	probably benign	0.13
R5896:Cmya5	UTSW	13	93045865	critical splice donor site	probably null
R5910:Cmya5	UTSW	13	93092643	missense	probably damaging	0.98
R5969:Cmya5	UTSW	13	93089544	missense	possibly damaging	0.78
R6064:Cmya5	UTSW	13	93089649	missense	probably damaging	1.00
R6081:Cmya5	UTSW	13	93144513	unclassified	probably benign
R6102:Cmya5	UTSW	13	93094231	missense	probably benign
R6117:Cmya5	UTSW	13	93095166	missense	probably damaging	0.98
R6188:Cmya5	UTSW	13	93093444	missense	possibly damaging	0.61
R6188:Cmya5	UTSW	13	93097276	missense	possibly damaging	0.73
R6219:Cmya5	UTSW	13	93094443	missense	probably damaging	1.00
R6229:Cmya5	UTSW	13	93093306	missense	probably benign	0.41
R6346:Cmya5	UTSW	13	93092190	missense	probably damaging	1.00
R6431:Cmya5	UTSW	13	93074464	missense	possibly damaging	0.60
R6436:Cmya5	UTSW	13	93089215	missense	probably damaging	0.98
R6598:Cmya5	UTSW	13	93089808	missense	probably benign	0.05
R6649:Cmya5	UTSW	13	93098025	missense	possibly damaging	0.91
R6652:Cmya5	UTSW	13	93092895	missense	probably benign	0.04
R6652:Cmya5	UTSW	13	93093039	missense	probably damaging	0.99
R6669:Cmya5	UTSW	13	93093259	missense	probably benign	0.03
R6881:Cmya5	UTSW	13	93090292	missense	probably damaging	1.00
R6909:Cmya5	UTSW	13	93091252	missense	probably benign	0.04
R6933:Cmya5	UTSW	13	93095136	missense	probably benign	0.03
R7021:Cmya5	UTSW	13	93093555	missense	possibly damaging	0.62
R7022:Cmya5	UTSW	13	93069278	critical splice donor site	probably null
R7068:Cmya5	UTSW	13	93092697	missense	possibly damaging	0.59
R7087:Cmya5	UTSW	13	93090975	missense	probably benign	0.00
R7088:Cmya5	UTSW	13	93091864	missense	possibly damaging	0.95
R7126:Cmya5	UTSW	13	93089940	missense	probably benign	0.41
R7177:Cmya5	UTSW	13	93095328	missense	probably benign	0.00
R7188:Cmya5	UTSW	13	93046038	missense	probably damaging	1.00
R7217:Cmya5	UTSW	13	93090430	missense	probably damaging	1.00
R7278:Cmya5	UTSW	13	93095700	missense	probably damaging	0.96
R7293:Cmya5	UTSW	13	93092797	missense	possibly damaging	0.90
R7332:Cmya5	UTSW	13	93092553	missense	possibly damaging	0.60
R7375:Cmya5	UTSW	13	93091661	missense	probably damaging	0.97
R7386:Cmya5	UTSW	13	93069323	missense	probably damaging	1.00
R7489:Cmya5	UTSW	13	93091838	missense	possibly damaging	0.87
R7529:Cmya5	UTSW	13	93097434	missense	probably benign	0.02
R7552:Cmya5	UTSW	13	93069312	missense	probably benign	0.41
R7624:Cmya5	UTSW	13	93090357	missense	possibly damaging	0.79
R7637:Cmya5	UTSW	13	93083212	missense	possibly damaging	0.87
R7673:Cmya5	UTSW	13	93094121	missense	probably benign	0.13
R7753:Cmya5	UTSW	13	93098172	missense	probably benign	0.18
R7757:Cmya5	UTSW	13	93098272	missense	possibly damaging	0.53
R7806:Cmya5	UTSW	13	93094262	missense	probably benign	0.00
R7825:Cmya5	UTSW	13	93097628	missense	possibly damaging	0.53
R7878:Cmya5	UTSW	13	93089757	missense	probably damaging	0.98
R7892:Cmya5	UTSW	13	93096357	missense	probably damaging	0.96
R7952:Cmya5	UTSW	13	93097004	small deletion	probably benign
R8127:Cmya5	UTSW	13	93094614	missense	probably damaging	0.99
R8256:Cmya5	UTSW	13	93093478	missense	possibly damaging	0.62
R8339:Cmya5	UTSW	13	93091634	nonsense	probably null
R8446:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R8553:Cmya5	UTSW	13	93093796	missense	probably benign	0.00
R8686:Cmya5	UTSW	13	93095380	missense	possibly damaging	0.91
R8748:Cmya5	UTSW	13	93089721	missense	probably damaging	1.00
R8783:Cmya5	UTSW	13	93089380	missense	possibly damaging	0.58
R8803:Cmya5	UTSW	13	93041483	missense	probably damaging	1.00
R8810:Cmya5	UTSW	13	93063540	missense	possibly damaging	0.47
R8937:Cmya5	UTSW	13	93096332	missense	probably benign	0.01
R8985:Cmya5	UTSW	13	93097156	missense	possibly damaging	0.73
R9017:Cmya5	UTSW	13	93092064	missense	probably benign	0.03
R9087:Cmya5	UTSW	13	93097203	missense	possibly damaging	0.72
R9133:Cmya5	UTSW	13	93097600	missense	possibly damaging	0.73
R9156:Cmya5	UTSW	13	93097370	missense	unknown
R9209:Cmya5	UTSW	13	93090358	missense	probably benign	0.45
R9222:Cmya5	UTSW	13	93094071	missense	probably benign	0.00
R9229:Cmya5	UTSW	13	93095668	missense	possibly damaging	0.92
R9382:Cmya5	UTSW	13	93093376	missense	probably benign
R9385:Cmya5	UTSW	13	93094372	missense	probably damaging	0.99
R9418:Cmya5	UTSW	13	93089701	missense	probably benign	0.22
R9452:Cmya5	UTSW	13	93095886	missense	probably benign
R9492:Cmya5	UTSW	13	93041314	makesense	probably null
R9600:Cmya5	UTSW	13	93090096	missense	probably damaging	1.00
R9712:Cmya5	UTSW	13	93065373	critical splice acceptor site	probably null
R9742:Cmya5	UTSW	13	93095427	missense	possibly damaging	0.89
RF020:Cmya5	UTSW	13	93069291	missense	possibly damaging	0.56
X0028:Cmya5	UTSW	13	93096687	missense	possibly damaging	0.53
Z1088:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93096790	missense	unknown
Z1177:Cmya5	UTSW	13	93063579	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGTCACGTATTCAGACGCTTGTTC -3'
(R):5'- CCCTCCAGTGCCAGAAATGATACAG -3'

Sequencing Primer
(F):5'- CTGTTTTTTCTGTTGAAATCGGCTC -3'
(R):5'- TCTCAGCCTTCCACAAATGATG -3'

Posted On

2014-05-23