Incidental Mutation 'R0089:Hepacam2'
ID20054
Institutional Source Beutler Lab
Gene Symbol Hepacam2
Ensembl Gene ENSMUSG00000044156
Gene NameHEPACAM family member 2
Synonyms
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R0089 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location3457096-3498298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3487094 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 12 (S12P)
Ref Sequence ENSEMBL: ENSMUSP00000143834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049985] [ENSMUST00000200854] [ENSMUST00000201607]
Predicted Effect probably damaging
Transcript: ENSMUST00000049985
AA Change: S88P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058882
Gene: ENSMUSG00000044156
AA Change: S88P

DomainStartEndE-ValueType
IG 39 142 7.77e-1 SMART
IGc2 165 227 6.21e-9 SMART
IG 256 334 1.87e0 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200854
AA Change: S12P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144362
Gene: ENSMUSG00000044156
AA Change: S12P

DomainStartEndE-ValueType
IG_like 2 66 2.88e1 SMART
IGc2 89 151 6.21e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201276
Predicted Effect probably damaging
Transcript: ENSMUST00000201607
AA Change: S12P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143834
Gene: ENSMUSG00000044156
AA Change: S12P

DomainStartEndE-ValueType
IG_like 2 66 1.2e-1 SMART
IGc2 89 151 2.5e-11 SMART
Blast:IG 180 206 9e-11 BLAST
Meta Mutation Damage Score 0.1473 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the immunoglobulin superfamily that plays a role in mitosis. Knockdown of this gene results in prometaphase arrest, abnormal nuclear morphology and apoptosis. Poly(ADP-ribosylation) of the encoded protein promotes its translocation to centrosomes, which may stimulate centrosome maturation. A chromosomal deletion including this gene may be associated with myeloid leukemia and myelodysplastic syndrome in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Hepacam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL01945:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL02254:Hepacam2 APN 6 3483421 missense probably benign 0.06
IGL02445:Hepacam2 APN 6 3483481 missense probably damaging 1.00
IGL02546:Hepacam2 APN 6 3483568 missense possibly damaging 0.93
IGL02620:Hepacam2 APN 6 3487280 splice site probably benign
IGL02697:Hepacam2 APN 6 3476036 missense possibly damaging 0.79
R0208:Hepacam2 UTSW 6 3467505 splice site probably benign
R0230:Hepacam2 UTSW 6 3463336 missense probably benign 0.01
R0299:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0499:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0608:Hepacam2 UTSW 6 3483479 missense possibly damaging 0.93
R1350:Hepacam2 UTSW 6 3467530 nonsense probably null
R1663:Hepacam2 UTSW 6 3483439 missense possibly damaging 0.76
R1749:Hepacam2 UTSW 6 3483379 missense probably damaging 1.00
R1997:Hepacam2 UTSW 6 3487241 missense probably damaging 1.00
R2146:Hepacam2 UTSW 6 3463378 splice site probably benign
R3911:Hepacam2 UTSW 6 3494477 start codon destroyed probably null 0.98
R4281:Hepacam2 UTSW 6 3475938 missense probably damaging 0.98
R4290:Hepacam2 UTSW 6 3487237 missense probably benign 0.01
R4371:Hepacam2 UTSW 6 3486988 missense probably damaging 1.00
R4794:Hepacam2 UTSW 6 3475933 missense probably damaging 0.96
R4890:Hepacam2 UTSW 6 3487231 missense probably damaging 0.96
R5330:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5331:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5677:Hepacam2 UTSW 6 3466142 missense probably damaging 1.00
R5796:Hepacam2 UTSW 6 3466200 unclassified probably null
R5844:Hepacam2 UTSW 6 3476073 missense probably damaging 0.99
R5979:Hepacam2 UTSW 6 3476149 missense probably damaging 1.00
R6017:Hepacam2 UTSW 6 3483332 missense probably damaging 1.00
R7460:Hepacam2 UTSW 6 3487199 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGAGGACTCACCATCGACAGTGAC -3'
(R):5'- AGATGTGGCTCAGGACACTCACAG -3'

Sequencing Primer
(F):5'- ACCATCGACAGTGACTTGTATC -3'
(R):5'- GCTCAGGACACTCACAGTTTTC -3'
Posted On2013-04-11