Incidental Mutation 'R1743:Cnnm1'
Institutional Source Beutler Lab
Gene Symbol Cnnm1
Ensembl Gene ENSMUSG00000025189
Gene Namecyclin M1
MMRRC Submission 039775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1743 (G1)
Quality Score225
Status Not validated
Chromosomal Location43440436-43497210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43471913 bp
Amino Acid Change Tyrosine to Phenylalanine at position 698 (Y698F)
Ref Sequence ENSEMBL: ENSMUSP00000153472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165311] [ENSMUST00000223787]
Predicted Effect probably benign
Transcript: ENSMUST00000165311
AA Change: Y698F

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131830
Gene: ENSMUSG00000025189
AA Change: Y698F

low complexity region 25 32 N/A INTRINSIC
low complexity region 78 95 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 165 183 N/A INTRINSIC
low complexity region 193 202 N/A INTRINSIC
Pfam:DUF21 224 414 1.8e-27 PFAM
Blast:CBS 438 489 2e-12 BLAST
CBS 505 561 5.02e0 SMART
Blast:cNMP 634 802 2e-44 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000223787
AA Change: Y698F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225421
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain protein family. The encoded protein may bind copper. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T A 11: 53,368,695 M11K possibly damaging Het
Ank2 T C 3: 126,928,675 D88G probably damaging Het
Arhgap32 A G 9: 32,259,431 E1169G probably benign Het
Atp7b A T 8: 22,006,387 V865E probably damaging Het
Bcl2l13 T A 6: 120,848,543 Y13* probably null Het
Birc6 A G 17: 74,579,756 Q693R possibly damaging Het
Bub1 T C 2: 127,813,850 D520G probably damaging Het
Ccdc15 A T 9: 37,277,477 Y770* probably null Het
Cenpf T C 1: 189,654,263 E1940G probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cmya5 A G 13: 93,097,317 V421A probably benign Het
Cnst C T 1: 179,610,392 T507I probably benign Het
Coq8a T C 1: 180,182,229 M4V probably benign Het
Csmd3 A G 15: 48,622,089 L140P probably damaging Het
Cul2 A T 18: 3,426,851 I431F probably damaging Het
Dnah8 G T 17: 30,769,651 E3198D probably benign Het
Epn2 T A 11: 61,546,411 I112F possibly damaging Het
Ext2 T C 2: 93,730,225 E532G probably damaging Het
Fndc3a A T 14: 72,652,081 V37E probably damaging Het
Gabbr2 A G 4: 46,677,603 F759S possibly damaging Het
Ghr G A 15: 3,320,241 P485L probably benign Het
Glipr1l2 G T 10: 112,092,565 V122L probably benign Het
Gm13128 T C 4: 144,333,005 S429P probably benign Het
Gm6871 G T 7: 41,546,452 T287K probably damaging Het
Gm7275 A G 16: 48,073,757 noncoding transcript Het
Hephl1 C T 9: 15,090,068 V254I probably damaging Het
Hnf4a C A 2: 163,566,339 Q362K possibly damaging Het
Kcne3 C T 7: 100,184,424 R83C probably damaging Het
Klb C A 5: 65,375,861 N504K probably damaging Het
Loxl2 T A 14: 69,692,402 I743N possibly damaging Het
Lrrc9 A T 12: 72,456,117 L287F probably damaging Het
Mcm3ap C T 10: 76,484,674 P822L possibly damaging Het
Nacc2 T C 2: 26,060,143 N527S probably benign Het
Ncam1 G T 9: 49,557,145 P338H probably damaging Het
Nfkbiz G T 16: 55,816,394 Q515K possibly damaging Het
Nipsnap2 T C 5: 129,757,085 L263P probably damaging Het
Nlrp1a A T 11: 71,124,206 S73T probably benign Het
Nomo1 G A 7: 46,070,037 probably null Het
Nos3 G A 5: 24,377,312 G594D probably benign Het
Olfr1330 A G 4: 118,893,526 T148A probably benign Het
Olfr1359 A G 13: 21,703,450 I150V probably benign Het
Olfr148 A T 9: 39,613,620 T18S possibly damaging Het
Oprm1 A G 10: 6,830,105 I256V probably damaging Het
Oxct2a A T 4: 123,323,516 L24Q possibly damaging Het
Pcdhb14 T G 18: 37,448,178 S112R probably benign Het
Polr2a A G 11: 69,739,503 I1246T probably damaging Het
Ppil4 A T 10: 7,807,381 K327N probably damaging Het
Pstpip1 T C 9: 56,125,930 Y249H probably damaging Het
Qrsl1 A T 10: 43,881,515 V369E probably damaging Het
Ranbp10 G T 8: 105,779,978 P237T probably damaging Het
Rapgef6 A G 11: 54,676,284 N1097S probably damaging Het
Repin1 T A 6: 48,597,750 S538T probably damaging Het
Rims2 A T 15: 39,679,650 M1151L probably benign Het
Rin3 T A 12: 102,390,096 D965E possibly damaging Het
Sdc2 A G 15: 33,028,078 D114G probably benign Het
Slc25a30 C A 14: 75,775,083 A42S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssh2 T A 11: 77,437,756 F383I probably damaging Het
St8sia1 A T 6: 142,829,016 V279E probably damaging Het
Tacc2 C A 7: 130,626,598 S1690* probably null Het
Taf1b A G 12: 24,547,178 D372G possibly damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem165 G T 5: 76,207,826 G272C probably damaging Het
Tsc22d2 TCAGTTAACACCTATGAACAGT TCAGT 3: 58,417,539 probably null Het
Tssk4 C A 14: 55,651,031 A119D probably damaging Het
Usp9y A G Y: 1,316,727 Y1941H probably damaging Het
Vmn2r42 A T 7: 8,184,265 M786K probably benign Het
Wdfy3 G T 5: 101,844,065 T3470K probably benign Het
Wdr63 C A 3: 146,097,262 R58L possibly damaging Het
Zc3h14 T C 12: 98,779,189 V479A probably benign Het
Zfp821 G A 8: 109,724,164 R263Q probably damaging Het
Other mutations in Cnnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Cnnm1 APN 19 43471936 missense probably benign 0.10
IGL02370:Cnnm1 APN 19 43471950 critical splice donor site probably null
R0329:Cnnm1 UTSW 19 43441910 missense probably damaging 1.00
R0400:Cnnm1 UTSW 19 43468364 missense probably damaging 1.00
R1417:Cnnm1 UTSW 19 43469723 missense probably benign 0.05
R1478:Cnnm1 UTSW 19 43471856 missense probably damaging 1.00
R2290:Cnnm1 UTSW 19 43491502 missense probably benign
R2509:Cnnm1 UTSW 19 43441886 missense probably damaging 1.00
R2910:Cnnm1 UTSW 19 43469647 missense possibly damaging 0.58
R3107:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3109:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3922:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R3923:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R4804:Cnnm1 UTSW 19 43491575 missense probably benign 0.02
R5199:Cnnm1 UTSW 19 43494986 missense possibly damaging 0.84
R5347:Cnnm1 UTSW 19 43441862 missense probably benign 0.42
R5595:Cnnm1 UTSW 19 43465157 missense possibly damaging 0.85
R5964:Cnnm1 UTSW 19 43469723 missense probably benign 0.42
R5969:Cnnm1 UTSW 19 43491472 missense probably damaging 1.00
R6383:Cnnm1 UTSW 19 43465266 critical splice donor site probably null
R7072:Cnnm1 UTSW 19 43440857 missense probably benign
R7092:Cnnm1 UTSW 19 43441948 missense probably damaging 1.00
R7126:Cnnm1 UTSW 19 43484853 missense probably damaging 1.00
R7432:Cnnm1 UTSW 19 43468271 missense probably benign 0.09
R7445:Cnnm1 UTSW 19 43440821 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-05-23