Mutagenetix > Incidental Mutations

Incidental Mutation 'R1744:Met'

200579

Institutional Source

Beutler Lab

Gene Symbol

Met

Ensembl Gene

ENSMUSG00000009376

Gene Name

met proto-oncogene

Synonyms

Par4, HGF receptor, c-Met

MMRRC Submission

039776-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1744 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17463800-17573980 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17540646 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 137 (V137A)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]

Predicted Effect

probably benign
Transcript: ENSMUST00000080469
AA Change: V857A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: V857A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115442
AA Change: V857A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: V857A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115443
AA Change: V857A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: V857A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145473

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152802
AA Change: V137A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000118755
Gene: ENSMUSG00000009376
AA Change: V137A

Domain	Start	End	E-Value	Type
IPT	21	116	3.38e-16	SMART
IPT	118	202	4.34e-5	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.8%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	A	G	5: 81,794,420	E1247G	probably damaging	Het
Bcl2l15	T	A	3: 103,838,540	L165Q	probably damaging	Het
Cd163	C	A	6: 124,307,028	A53E	possibly damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Clca3a1	G	T	3: 144,746,835	A629D	probably damaging	Het
Csde1	T	A	3: 103,050,315	S463R	probably benign	Het
Cth	C	G	3: 157,906,268	R304P	probably damaging	Het
D7Ertd443e	A	G	7: 134,349,413	V177A	probably benign	Het
Ddx56	G	A	11: 6,266,396	R189W	probably damaging	Het
Dennd2a	A	T	6: 39,480,251	F752L	probably benign	Het
Gabrp	A	T	11: 33,572,462	V28E	probably benign	Het
Gpam	T	C	19: 55,074,591	E763G	probably damaging	Het
Hars	G	A	18: 36,770,832	R266C	probably benign	Het
Klf7	C	A	1: 64,079,213	R75L	possibly damaging	Het
Kmt2d	T	C	15: 98,865,047	K281E	probably damaging	Het
Lbx1	T	C	19: 45,234,213	K124E	probably damaging	Het
Lcp2	T	C	11: 34,069,911		probably null	Het
Mab21l2	T	C	3: 86,546,904	E263G	possibly damaging	Het
Macf1	A	T	4: 123,475,853	I140K	probably damaging	Het
Mcemp1	G	A	8: 3,666,054	A20T	probably damaging	Het
Mgat5	T	C	1: 127,479,469	F624S	probably damaging	Het
Nutm2	T	C	13: 50,469,354	I29T	probably benign	Het
Ociad1	T	C	5: 73,300,719		probably null	Het
Ogfod2	G	A	5: 124,114,156		probably null	Het
Olfr816	A	C	10: 129,911,393	V295G	probably damaging	Het
Olfr967	A	C	9: 39,750,415	T10P	probably benign	Het
Otoa	G	A	7: 121,127,776		probably benign	Het
Otud3	A	C	4: 138,895,748	L394R	probably damaging	Het
Pde5a	T	C	3: 122,747,897	V12A	probably damaging	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Prr27	A	G	5: 87,843,047	I173V	possibly damaging	Het
Psg29	T	C	7: 17,210,353	C263R	probably damaging	Het
Ptprm	T	C	17: 66,689,366	Y1242C	probably damaging	Het
Retsat	C	T	6: 72,606,575	R84*	probably null	Het
Rif1	G	A	2: 52,112,392	V1953I	possibly damaging	Het
Ros1	A	T	10: 52,123,379	N1137K	probably damaging	Het
Scn1a	T	C	2: 66,322,276	H787R	probably benign	Het
Sec16a	T	C	2: 26,439,186	E939G	probably damaging	Het
Sh2d4a	G	A	8: 68,331,155	G247D	possibly damaging	Het
Siglec1	A	G	2: 131,081,299	S509P	probably damaging	Het
Slc25a30	A	G	14: 75,763,330	I278T	probably damaging	Het
Slc6a20a	C	T	9: 123,662,993	V104I	probably benign	Het
Sp110	G	C	1: 85,594,372	T70S	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Stxbp1	A	G	2: 32,806,719		probably null	Het
Tmem132b	T	C	5: 125,778,844		probably null	Het
Tmem2	C	A	19: 21,832,137	Y960*	probably null	Het
Tnfsf13b	G	A	8: 10,031,661		probably null	Het
Trappc6a	A	G	7: 19,514,229	E38G	probably damaging	Het
Trps1	T	C	15: 50,661,213	D857G	probably damaging	Het
Tspear	T	A	10: 77,864,884		probably null	Het
Vmn1r23	A	T	6: 57,925,925	N289K	possibly damaging	Het
Zcchc8	G	A	5: 123,700,373	Q701*	probably null	Het
Zfp618	A	T	4: 63,086,634		probably benign	Het

Other mutations in Met

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00533:Met	APN	6	17534937	unclassified	probably benign
IGL01066:Met	APN	6	17535105	critical splice donor site	probably null
IGL01344:Met	APN	6	17547032	missense	probably benign	0.44
IGL01413:Met	APN	6	17558896	splice site	probably benign
IGL01608:Met	APN	6	17558730	missense	probably damaging	1.00
IGL01613:Met	APN	6	17540577	missense	probably damaging	1.00
IGL01820:Met	APN	6	17534231	missense	possibly damaging	0.89
IGL01843:Met	APN	6	17491701	missense	probably damaging	1.00
IGL02014:Met	APN	6	17527257	splice site	probably benign
IGL02027:Met	APN	6	17563727	splice site	probably benign
IGL02243:Met	APN	6	17549094	missense	probably damaging	1.00
IGL02373:Met	APN	6	17491529	missense	probably damaging	1.00
IGL02616:Met	APN	6	17553347	missense	probably damaging	1.00
IGL02702:Met	APN	6	17534143	missense	possibly damaging	0.92
IGL02704:Met	APN	6	17491257	missense	possibly damaging	0.62
IGL02714:Met	APN	6	17491852	nonsense	probably null
IGL02936:Met	APN	6	17553397	missense	probably damaging	1.00
IGL02943:Met	APN	6	17535929	missense	possibly damaging	0.84
IGL03057:Met	APN	6	17558766	missense	probably damaging	1.00
IGL03124:Met	APN	6	17492078	missense	probably benign	0.27
IGL03171:Met	APN	6	17562273	splice site	probably benign
IGL03266:Met	APN	6	17540538	missense	possibly damaging	0.61
IGL03285:Met	APN	6	17553337	missense	probably damaging	0.98
R0453:Met	UTSW	6	17534198	missense	possibly damaging	0.88
R0543:Met	UTSW	6	17491970	missense	probably damaging	1.00
R0601:Met	UTSW	6	17555632	splice site	probably null
R0652:Met	UTSW	6	17491710	missense	probably benign	0.00
R0941:Met	UTSW	6	17491394	missense	probably damaging	1.00
R1142:Met	UTSW	6	17527183	nonsense	probably null
R1553:Met	UTSW	6	17491461	missense	probably benign	0.01
R1569:Met	UTSW	6	17531504	nonsense	probably null
R2224:Met	UTSW	6	17563722	splice site	probably null
R2308:Met	UTSW	6	17491742	missense	probably benign	0.00
R2369:Met	UTSW	6	17531528	missense	probably benign	0.04
R2393:Met	UTSW	6	17534198	missense	probably damaging	0.99
R2419:Met	UTSW	6	17535830	splice site	probably benign
R2483:Met	UTSW	6	17549086	missense	probably damaging	1.00
R2511:Met	UTSW	6	17491967	missense	probably damaging	1.00
R3622:Met	UTSW	6	17549086	missense	probably damaging	1.00
R3623:Met	UTSW	6	17549086	missense	probably damaging	1.00
R3624:Met	UTSW	6	17549086	missense	probably damaging	1.00
R4050:Met	UTSW	6	17533984	missense	probably benign
R4051:Met	UTSW	6	17548729	missense	possibly damaging	0.86
R4159:Met	UTSW	6	17562272	splice site	probably null
R4208:Met	UTSW	6	17548729	missense	possibly damaging	0.86
R4622:Met	UTSW	6	17513384	missense	probably benign	0.19
R4672:Met	UTSW	6	17571804	missense	probably benign	0.33
R4737:Met	UTSW	6	17491541	missense	probably damaging	1.00
R4738:Met	UTSW	6	17491541	missense	probably damaging	1.00
R4834:Met	UTSW	6	17491413	missense	probably damaging	0.97
R4846:Met	UTSW	6	17491929	missense	probably damaging	0.99
R4855:Met	UTSW	6	17558797	missense	probably damaging	1.00
R4878:Met	UTSW	6	17549059	missense	probably damaging	1.00
R4902:Met	UTSW	6	17546996	missense	probably damaging	1.00
R5208:Met	UTSW	6	17526423	nonsense	probably null
R5355:Met	UTSW	6	17491362	missense	probably damaging	1.00
R5415:Met	UTSW	6	17527085	missense	probably benign	0.01
R5556:Met	UTSW	6	17534176	missense	probably benign	0.04
R5590:Met	UTSW	6	17548782	missense	probably benign	0.00
R5683:Met	UTSW	6	17571744	missense	probably damaging	1.00
R5872:Met	UTSW	6	17562198	missense	probably damaging	1.00
R5891:Met	UTSW	6	17491539	missense	probably benign	0.02
R5895:Met	UTSW	6	17531582	missense	probably benign	0.02
R6063:Met	UTSW	6	17491968	missense	probably damaging	1.00
R6262:Met	UTSW	6	17553404	missense	probably benign	0.00
R6362:Met	UTSW	6	17558733	missense	probably damaging	1.00
R6747:Met	UTSW	6	17571467	missense	probably damaging	1.00
R6966:Met	UTSW	6	17531532	missense	possibly damaging	0.65
R6989:Met	UTSW	6	17535928	missense	possibly damaging	0.67
R6989:Met	UTSW	6	17535929	missense	probably damaging	1.00
R7017:Met	UTSW	6	17491287	nonsense	probably null
R7037:Met	UTSW	6	17547128	intron	probably benign
R7141:Met	UTSW	6	17527155	missense	probably benign	0.01
R7242:Met	UTSW	6	17491317	missense	probably damaging	1.00
R7282:Met	UTSW	6	17547012	nonsense	probably null
R7624:Met	UTSW	6	17558835	missense	probably damaging	1.00
R7770:Met	UTSW	6	17491407	missense	possibly damaging	0.79
R7797:Met	UTSW	6	17533953	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACTACTCCTTCACTGAAACAGC -3'
(R):5'- TCATCATGACAGCATTGGCGGG -3'

Sequencing Primer
(F):5'- CCTGTTAGACGGGATTCTTTCC -3'
(R):5'- AAGGGGGTCTTAAATGCTTCATTAG -3'

Posted On

2014-05-23