Incidental Mutation 'R1744:Gabrp'
ID200600
Institutional Source Beutler Lab
Gene Symbol Gabrp
Ensembl Gene ENSMUSG00000020159
Gene Namegamma-aminobutyric acid (GABA) A receptor, pi
Synonyms
MMRRC Submission 039776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1744 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location33550781-33578959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33572462 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 28 (V28E)
Ref Sequence ENSEMBL: ENSMUSP00000020366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020366] [ENSMUST00000135350]
Predicted Effect probably benign
Transcript: ENSMUST00000020366
AA Change: V28E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020366
Gene: ENSMUSG00000020159
AA Change: V28E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 242 1.3e-49 PFAM
Pfam:Neur_chan_memb 249 353 5.2e-23 PFAM
transmembrane domain 420 437 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135350
AA Change: V28E
SMART Domains Protein: ENSMUSP00000120500
Gene: ENSMUSG00000020159
AA Change: V28E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A G 5: 81,794,420 E1247G probably damaging Het
Bcl2l15 T A 3: 103,838,540 L165Q probably damaging Het
Cd163 C A 6: 124,307,028 A53E possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clca3a1 G T 3: 144,746,835 A629D probably damaging Het
Csde1 T A 3: 103,050,315 S463R probably benign Het
Cth C G 3: 157,906,268 R304P probably damaging Het
D7Ertd443e A G 7: 134,349,413 V177A probably benign Het
Ddx56 G A 11: 6,266,396 R189W probably damaging Het
Dennd2a A T 6: 39,480,251 F752L probably benign Het
Gpam T C 19: 55,074,591 E763G probably damaging Het
Hars G A 18: 36,770,832 R266C probably benign Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2d T C 15: 98,865,047 K281E probably damaging Het
Lbx1 T C 19: 45,234,213 K124E probably damaging Het
Lcp2 T C 11: 34,069,911 probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 A T 4: 123,475,853 I140K probably damaging Het
Mcemp1 G A 8: 3,666,054 A20T probably damaging Het
Met T C 6: 17,540,646 V137A possibly damaging Het
Mgat5 T C 1: 127,479,469 F624S probably damaging Het
Nutm2 T C 13: 50,469,354 I29T probably benign Het
Ociad1 T C 5: 73,300,719 probably null Het
Ogfod2 G A 5: 124,114,156 probably null Het
Olfr816 A C 10: 129,911,393 V295G probably damaging Het
Olfr967 A C 9: 39,750,415 T10P probably benign Het
Otoa G A 7: 121,127,776 probably benign Het
Otud3 A C 4: 138,895,748 L394R probably damaging Het
Pde5a T C 3: 122,747,897 V12A probably damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prr27 A G 5: 87,843,047 I173V possibly damaging Het
Psg29 T C 7: 17,210,353 C263R probably damaging Het
Ptprm T C 17: 66,689,366 Y1242C probably damaging Het
Retsat C T 6: 72,606,575 R84* probably null Het
Rif1 G A 2: 52,112,392 V1953I possibly damaging Het
Ros1 A T 10: 52,123,379 N1137K probably damaging Het
Scn1a T C 2: 66,322,276 H787R probably benign Het
Sec16a T C 2: 26,439,186 E939G probably damaging Het
Sh2d4a G A 8: 68,331,155 G247D possibly damaging Het
Siglec1 A G 2: 131,081,299 S509P probably damaging Het
Slc25a30 A G 14: 75,763,330 I278T probably damaging Het
Slc6a20a C T 9: 123,662,993 V104I probably benign Het
Sp110 G C 1: 85,594,372 T70S probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stxbp1 A G 2: 32,806,719 probably null Het
Tmem132b T C 5: 125,778,844 probably null Het
Tmem2 C A 19: 21,832,137 Y960* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc6a A G 7: 19,514,229 E38G probably damaging Het
Trps1 T C 15: 50,661,213 D857G probably damaging Het
Tspear T A 10: 77,864,884 probably null Het
Vmn1r23 A T 6: 57,925,925 N289K possibly damaging Het
Zcchc8 G A 5: 123,700,373 Q701* probably null Het
Zfp618 A T 4: 63,086,634 probably benign Het
Other mutations in Gabrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gabrp APN 11 33552644 missense possibly damaging 0.91
IGL01299:Gabrp APN 11 33554476 missense probably damaging 1.00
IGL01305:Gabrp APN 11 33555055 missense probably damaging 1.00
IGL01686:Gabrp APN 11 33552826 nonsense probably null
IGL01729:Gabrp APN 11 33552689 missense probably damaging 1.00
IGL03031:Gabrp APN 11 33554980 missense probably damaging 1.00
IGL03172:Gabrp APN 11 33554388 missense probably damaging 1.00
IGL03280:Gabrp APN 11 33552616 missense probably benign 0.12
ANU22:Gabrp UTSW 11 33555055 missense probably damaging 1.00
R0265:Gabrp UTSW 11 33552614 missense probably damaging 1.00
R0326:Gabrp UTSW 11 33554362 missense probably damaging 0.99
R4174:Gabrp UTSW 11 33568092 missense probably damaging 1.00
R5043:Gabrp UTSW 11 33568072 missense probably benign 0.00
R5213:Gabrp UTSW 11 33567211 critical splice donor site probably null
R5290:Gabrp UTSW 11 33567310 missense probably damaging 0.99
R5665:Gabrp UTSW 11 33554308 missense possibly damaging 0.56
R6698:Gabrp UTSW 11 33557017 missense probably damaging 1.00
Z1176:Gabrp UTSW 11 33552673 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAACCAGTTGCCCATCAGGACG -3'
(R):5'- TGGAGGGTTTGCCAATTATCATGAGAG -3'

Sequencing Primer
(F):5'- CATCAGGACGGAGTCAGC -3'
(R):5'- CACAAGGGAGGGCCAATTAA -3'
Posted On2014-05-23