Incidental Mutation 'R0727:Olfr153'
ID200625
Institutional Source Beutler Lab
Gene Symbol Olfr153
Ensembl Gene ENSMUSG00000061520
Gene Nameolfactory receptor 153
SynonymsGA_x6K02T2Q125-49033418-49034341, MOR177-5, Olfr4-2, V5
MMRRC Submission 038909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0727 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87531796-87533053 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87532901 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 289 (Y289*)
Ref Sequence ENSEMBL: ENSMUSP00000149859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077471] [ENSMUST00000217113]
Predicted Effect probably null
Transcript: ENSMUST00000077471
AA Change: Y289*
SMART Domains Protein: ENSMUSP00000076681
Gene: ENSMUSG00000075151
AA Change: Y289*

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6e-48 PFAM
Pfam:7tm_1 40 289 2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217113
AA Change: Y289*
Meta Mutation Damage Score 0.9657 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A G 13: 98,984,227 V97A probably benign Het
2810474O19Rik A G 6: 149,325,822 N122S possibly damaging Het
Actr3b T C 5: 25,811,939 V83A possibly damaging Het
Adam2 A G 14: 66,029,731 I693T probably damaging Het
Adamts1 T C 16: 85,798,648 D214G possibly damaging Het
Atp6v1h T A 1: 5,084,558 Y36* probably null Het
Cacna1d A G 14: 30,130,115 probably null Het
Catsperb G T 12: 101,594,355 probably null Het
Ccdc88b T C 19: 6,854,214 M482V probably benign Het
Cemip T C 7: 83,961,578 K723E probably benign Het
Cep112 G A 11: 108,506,554 R375H probably damaging Het
Cpne7 T C 8: 123,126,286 S211P probably damaging Het
Csde1 A G 3: 103,043,638 T191A probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dlc1 A G 8: 36,572,674 V1027A probably damaging Het
Ergic2 T A 6: 148,199,400 probably benign Het
Evpl T C 11: 116,232,485 H307R probably damaging Het
Faah A G 4: 116,005,060 I242T probably damaging Het
Farsa T A 8: 84,861,304 probably null Het
Fat3 A C 9: 15,996,699 L2669R probably damaging Het
Fgfr4 C A 13: 55,156,228 probably null Het
Gnl3 A G 14: 31,017,077 S55P probably damaging Het
Grhl3 T A 4: 135,546,254 K562N possibly damaging Het
Hoxa9 A G 6: 52,224,314 V249A probably damaging Het
Hyal1 T C 9: 107,578,402 S304P possibly damaging Het
Igf1r T C 7: 68,212,158 probably null Het
Kif3c A G 12: 3,366,776 T266A probably benign Het
Lrp1b T C 2: 40,750,944 D3496G probably benign Het
Man2b1 T G 8: 85,091,526 V442G probably damaging Het
Mast1 T C 8: 84,921,415 Y479C probably damaging Het
Mei1 A G 15: 82,070,149 T52A probably benign Het
Micall1 A G 15: 79,120,778 D150G probably benign Het
Muc4 A G 16: 32,769,847 M2927V probably benign Het
Olfr1065 T C 2: 86,445,938 M15V probably benign Het
Olfr1082 A T 2: 86,594,380 Y149* probably null Het
Olfr1436 T C 19: 12,299,094 I13V probably benign Het
Olfr504 C T 7: 108,565,108 R229H probably benign Het
Olfr745 G T 14: 50,643,003 V241L probably damaging Het
Pabpc2 A C 18: 39,775,134 Q484P probably benign Het
Pbld2 T A 10: 63,067,519 V125D probably benign Het
Pkhd1l1 A G 15: 44,535,788 T2083A possibly damaging Het
Pum2 A G 12: 8,744,465 E785G probably damaging Het
Qser1 A G 2: 104,777,311 probably benign Het
R3hcc1l A G 19: 42,576,075 D29G probably damaging Het
Rabep1 T A 11: 70,900,492 Y180* probably null Het
Rassf5 T C 1: 131,181,265 S140G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T A 7: 5,115,293 I93L probably benign Het
Rnf219 G C 14: 104,480,188 L250V probably damaging Het
Ryr2 C T 13: 11,566,885 G4798D probably damaging Het
Scaf11 G A 15: 96,419,443 P747S probably damaging Het
Sgo2b T G 8: 63,927,782 K672T probably damaging Het
Smg1 T C 7: 118,166,422 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssh3 G T 19: 4,263,991 H439Q probably damaging Het
Steap3 T A 1: 120,227,817 T471S possibly damaging Het
Stk33 T A 7: 109,321,518 I208L probably damaging Het
Sucnr1 A G 3: 60,086,660 Y203C probably benign Het
Tlr11 T C 14: 50,361,469 I304T possibly damaging Het
Top2a A T 11: 99,012,148 C404* probably null Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Zcwpw1 T C 5: 137,810,807 probably benign Het
Zfhx4 A T 3: 5,401,073 H2097L probably damaging Het
Zfp874b T C 13: 67,474,712 K156E probably damaging Het
Zfyve16 T C 13: 92,493,878 K1413E possibly damaging Het
Other mutations in Olfr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Olfr153 APN 2 87532285 missense probably benign 0.01
IGL02102:Olfr153 APN 2 87532461 missense probably benign
IGL02604:Olfr153 APN 2 87532605 missense probably damaging 0.98
IGL02695:Olfr153 APN 2 87532117 missense probably benign 0.00
IGL02961:Olfr153 APN 2 87532684 missense probably damaging 0.98
PIT4696001:Olfr153 UTSW 2 87532780 missense probably damaging 1.00
R1534:Olfr153 UTSW 2 87532672 missense probably damaging 0.99
R1699:Olfr153 UTSW 2 87532083 missense probably benign 0.07
R1885:Olfr153 UTSW 2 87532824 missense probably damaging 0.99
R3705:Olfr153 UTSW 2 87532068 missense probably benign 0.01
R5664:Olfr153 UTSW 2 87532834 missense probably benign 0.35
R6492:Olfr153 UTSW 2 87532741 missense possibly damaging 0.66
R6808:Olfr153 UTSW 2 87532941 missense probably benign
R7432:Olfr153 UTSW 2 87532440 missense probably damaging 1.00
R7477:Olfr153 UTSW 2 87532087 missense probably benign 0.00
R8014:Olfr153 UTSW 2 87532164 missense probably benign 0.13
X0028:Olfr153 UTSW 2 87532039 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTTCCTTGAACTGAGCACCATC -3'
(R):5'- AGACTACGCCTTGCTCTGTTATGC -3'

Sequencing Primer
(F):5'- TTGAACTGAGCACCATCTCAGG -3'
(R):5'- AACAAATGCGGTagactgagg -3'
Posted On2014-05-23