Mutagenetix > Incidental Mutation

Incidental Mutation 'R0727:Mast1'

200650

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

SAST170, SAST, 9430008B02Rik

MMRRC Submission

038909-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0727 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84911903-84937359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84921415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 479 (Y479C)

Ref Sequence

ENSEMBL: ENSMUSP00000113547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]

AlphaFold

Q9R1L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000109741
AA Change: Y479C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: Y479C

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119820
AA Change: Y479C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: Y479C

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175085

Meta Mutation Damage Score

0.9210

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

99% (70/71)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	A	G	13: 98,984,227	V97A	probably benign	Het
2810474O19Rik	A	G	6: 149,325,822	N122S	possibly damaging	Het
Actr3b	T	C	5: 25,811,939	V83A	possibly damaging	Het
Adam2	A	G	14: 66,029,731	I693T	probably damaging	Het
Adamts1	T	C	16: 85,798,648	D214G	possibly damaging	Het
Atp6v1h	T	A	1: 5,084,558	Y36*	probably null	Het
Cacna1d	A	G	14: 30,130,115		probably null	Het
Catsperb	G	T	12: 101,594,355		probably null	Het
Ccdc88b	T	C	19: 6,854,214	M482V	probably benign	Het
Cemip	T	C	7: 83,961,578	K723E	probably benign	Het
Cep112	G	A	11: 108,506,554	R375H	probably damaging	Het
Cpne7	T	C	8: 123,126,286	S211P	probably damaging	Het
Csde1	A	G	3: 103,043,638	T191A	probably benign	Het
Dapk3	A	G	10: 81,190,262	Y129C	probably damaging	Het
Dlc1	A	G	8: 36,572,674	V1027A	probably damaging	Het
Ergic2	T	A	6: 148,199,400		probably benign	Het
Evpl	T	C	11: 116,232,485	H307R	probably damaging	Het
Faah	A	G	4: 116,005,060	I242T	probably damaging	Het
Farsa	T	A	8: 84,861,304		probably null	Het
Fat3	A	C	9: 15,996,699	L2669R	probably damaging	Het
Fgfr4	C	A	13: 55,156,228		probably null	Het
Gnl3	A	G	14: 31,017,077	S55P	probably damaging	Het
Grhl3	T	A	4: 135,546,254	K562N	possibly damaging	Het
Hoxa9	A	G	6: 52,224,314	V249A	probably damaging	Het
Hyal1	T	C	9: 107,578,402	S304P	possibly damaging	Het
Igf1r	T	C	7: 68,212,158		probably null	Het
Kif3c	A	G	12: 3,366,776	T266A	probably benign	Het
Lrp1b	T	C	2: 40,750,944	D3496G	probably benign	Het
Man2b1	T	G	8: 85,091,526	V442G	probably damaging	Het
Mei1	A	G	15: 82,070,149	T52A	probably benign	Het
Micall1	A	G	15: 79,120,778	D150G	probably benign	Het
Muc4	A	G	16: 32,769,847	M2927V	probably benign	Het
Olfr1065	T	C	2: 86,445,938	M15V	probably benign	Het
Olfr1082	A	T	2: 86,594,380	Y149*	probably null	Het
Olfr1436	T	C	19: 12,299,094	I13V	probably benign	Het
Olfr153	T	A	2: 87,532,901	Y289*	probably null	Het
Olfr504	C	T	7: 108,565,108	R229H	probably benign	Het
Olfr745	G	T	14: 50,643,003	V241L	probably damaging	Het
Pabpc2	A	C	18: 39,775,134	Q484P	probably benign	Het
Pbld2	T	A	10: 63,067,519	V125D	probably benign	Het
Pkhd1l1	A	G	15: 44,535,788	T2083A	possibly damaging	Het
Pum2	A	G	12: 8,744,465	E785G	probably damaging	Het
Qser1	A	G	2: 104,777,311		probably benign	Het
R3hcc1l	A	G	19: 42,576,075	D29G	probably damaging	Het
Rabep1	T	A	11: 70,900,492	Y180*	probably null	Het
Rassf5	T	C	1: 131,181,265	S140G	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rfpl4	T	A	7: 5,115,293	I93L	probably benign	Het
Rnf219	G	C	14: 104,480,188	L250V	probably damaging	Het
Ryr2	C	T	13: 11,566,885	G4798D	probably damaging	Het
Scaf11	G	A	15: 96,419,443	P747S	probably damaging	Het
Sgo2b	T	G	8: 63,927,782	K672T	probably damaging	Het
Smg1	T	C	7: 118,166,422		probably benign	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Ssh3	G	T	19: 4,263,991	H439Q	probably damaging	Het
Steap3	T	A	1: 120,227,817	T471S	possibly damaging	Het
Stk33	T	A	7: 109,321,518	I208L	probably damaging	Het
Sucnr1	A	G	3: 60,086,660	Y203C	probably benign	Het
Tlr11	T	C	14: 50,361,469	I304T	possibly damaging	Het
Top2a	A	T	11: 99,012,148	C404*	probably null	Het
Trim43a	G	A	9: 88,582,146	E37K	probably benign	Het
Zcwpw1	T	C	5: 137,810,807		probably benign	Het
Zfhx4	A	T	3: 5,401,073	H2097L	probably damaging	Het
Zfp874b	T	C	13: 67,474,712	K156E	probably damaging	Het
Zfyve16	T	C	13: 92,493,878	K1413E	possibly damaging	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	84912815	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	84913246	splice site	probably null
IGL01918:Mast1	APN	8	84921209	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	84921397	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	84918755	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	84912254	missense	probably benign
IGL02470:Mast1	APN	8	84921212	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	84917771	missense	probably benign
IGL02716:Mast1	APN	8	84935723	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	84925719	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	84913353	missense	probably benign	0.01
R0255:Mast1	UTSW	8	84912021	missense	probably benign
R0388:Mast1	UTSW	8	84915537	missense	probably benign	0.13
R0480:Mast1	UTSW	8	84913089	missense	probably damaging	0.99
R1175:Mast1	UTSW	8	84925327	missense	probably benign	0.29
R1297:Mast1	UTSW	8	84912716	missense	probably benign	0.05
R1328:Mast1	UTSW	8	84917988	intron	probably benign
R1454:Mast1	UTSW	8	84920635	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	84928609	nonsense	probably null
R1752:Mast1	UTSW	8	84925336	missense	probably benign
R1777:Mast1	UTSW	8	84912068	missense	probably benign
R1905:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	84920366	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	84921194	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	84921478	missense	probably damaging	1.00
R2318:Mast1	UTSW	8	84921125	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	84923908	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	84918731	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	84935723	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	84918764	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	84920891	missense	probably damaging	1.00
R4533:Mast1	UTSW	8	84921361	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	84929006	missense	possibly damaging	0.93
R4770:Mast1	UTSW	8	84929246	missense	probably benign	0.02
R4776:Mast1	UTSW	8	84937193	critical splice donor site	probably null
R4835:Mast1	UTSW	8	84923779	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	84920658	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	84918728	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	84917871	missense	probably benign
R4978:Mast1	UTSW	8	84935787	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	84913518	unclassified	probably benign
R5235:Mast1	UTSW	8	84913439	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R5463:Mast1	UTSW	8	84925507	missense	probably damaging	1.00
R5546:Mast1	UTSW	8	84916260	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	84928968	nonsense	probably null
R6124:Mast1	UTSW	8	84925307	missense	probably benign	0.01
R6213:Mast1	UTSW	8	84915569	missense	probably damaging	1.00
R6717:Mast1	UTSW	8	84917754	missense	probably benign
R7000:Mast1	UTSW	8	84928969	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	84911945	nonsense	probably null
R7164:Mast1	UTSW	8	84935304	missense	possibly damaging	0.81
R7695:Mast1	UTSW	8	84920928	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	84925325	nonsense	probably null
R7882:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R8167:Mast1	UTSW	8	84921358	missense	probably damaging	1.00
R8197:Mast1	UTSW	8	84912821	missense	possibly damaging	0.90
R8773:Mast1	UTSW	8	84916324	missense	probably damaging	1.00
R9477:Mast1	UTSW	8	84912150	missense	probably benign	0.18
R9526:Mast1	UTSW	8	84921176	missense	probably damaging	1.00
R9557:Mast1	UTSW	8	84930845	missense	probably damaging	1.00
R9655:Mast1	UTSW	8	84924031	missense	probably damaging	1.00
X0066:Mast1	UTSW	8	84920878	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	84912459	missense	probably damaging	0.97
Z1176:Mast1	UTSW	8	84918681	missense	probably damaging	1.00
Z1177:Mast1	UTSW	8	84920446	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AAGTGAGATCCTTGCCCTTCACCC -3'
(R):5'- TGTGACCAGACTTCTCTCTGAGTCC -3'

Sequencing Primer
(F):5'- CCTGGGTCTTCCAAGGAAC -3'
(R):5'- TCTGAGACTTGGAAAGGCTCC -3'

Posted On

2014-05-23