Incidental Mutation 'R0727:Man2b1'
ID200651
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Namemannosidase 2, alpha B1
Synonymslysosomal alpha-mannosidase
MMRRC Submission 038909-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0727 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85083270-85098282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85091526 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 442 (V442G)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000209361]
Predicted Effect probably damaging
Transcript: ENSMUST00000034121
AA Change: V442G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: V442G

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211379
Meta Mutation Damage Score 0.7642 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A G 13: 98,984,227 V97A probably benign Het
2810474O19Rik A G 6: 149,325,822 N122S possibly damaging Het
Actr3b T C 5: 25,811,939 V83A possibly damaging Het
Adam2 A G 14: 66,029,731 I693T probably damaging Het
Adamts1 T C 16: 85,798,648 D214G possibly damaging Het
Atp6v1h T A 1: 5,084,558 Y36* probably null Het
Cacna1d A G 14: 30,130,115 probably null Het
Catsperb G T 12: 101,594,355 probably null Het
Ccdc88b T C 19: 6,854,214 M482V probably benign Het
Cemip T C 7: 83,961,578 K723E probably benign Het
Cep112 G A 11: 108,506,554 R375H probably damaging Het
Cpne7 T C 8: 123,126,286 S211P probably damaging Het
Csde1 A G 3: 103,043,638 T191A probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dlc1 A G 8: 36,572,674 V1027A probably damaging Het
Ergic2 T A 6: 148,199,400 probably benign Het
Evpl T C 11: 116,232,485 H307R probably damaging Het
Faah A G 4: 116,005,060 I242T probably damaging Het
Farsa T A 8: 84,861,304 probably null Het
Fat3 A C 9: 15,996,699 L2669R probably damaging Het
Fgfr4 C A 13: 55,156,228 probably null Het
Gnl3 A G 14: 31,017,077 S55P probably damaging Het
Grhl3 T A 4: 135,546,254 K562N possibly damaging Het
Hoxa9 A G 6: 52,224,314 V249A probably damaging Het
Hyal1 T C 9: 107,578,402 S304P possibly damaging Het
Igf1r T C 7: 68,212,158 probably null Het
Kif3c A G 12: 3,366,776 T266A probably benign Het
Lrp1b T C 2: 40,750,944 D3496G probably benign Het
Mast1 T C 8: 84,921,415 Y479C probably damaging Het
Mei1 A G 15: 82,070,149 T52A probably benign Het
Micall1 A G 15: 79,120,778 D150G probably benign Het
Muc4 A G 16: 32,769,847 M2927V probably benign Het
Olfr1065 T C 2: 86,445,938 M15V probably benign Het
Olfr1082 A T 2: 86,594,380 Y149* probably null Het
Olfr1436 T C 19: 12,299,094 I13V probably benign Het
Olfr153 T A 2: 87,532,901 Y289* probably null Het
Olfr504 C T 7: 108,565,108 R229H probably benign Het
Olfr745 G T 14: 50,643,003 V241L probably damaging Het
Pabpc2 A C 18: 39,775,134 Q484P probably benign Het
Pbld2 T A 10: 63,067,519 V125D probably benign Het
Pkhd1l1 A G 15: 44,535,788 T2083A possibly damaging Het
Pum2 A G 12: 8,744,465 E785G probably damaging Het
Qser1 A G 2: 104,777,311 probably benign Het
R3hcc1l A G 19: 42,576,075 D29G probably damaging Het
Rabep1 T A 11: 70,900,492 Y180* probably null Het
Rassf5 T C 1: 131,181,265 S140G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T A 7: 5,115,293 I93L probably benign Het
Rnf219 G C 14: 104,480,188 L250V probably damaging Het
Ryr2 C T 13: 11,566,885 G4798D probably damaging Het
Scaf11 G A 15: 96,419,443 P747S probably damaging Het
Sgo2b T G 8: 63,927,782 K672T probably damaging Het
Smg1 T C 7: 118,166,422 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssh3 G T 19: 4,263,991 H439Q probably damaging Het
Steap3 T A 1: 120,227,817 T471S possibly damaging Het
Stk33 T A 7: 109,321,518 I208L probably damaging Het
Sucnr1 A G 3: 60,086,660 Y203C probably benign Het
Tlr11 T C 14: 50,361,469 I304T possibly damaging Het
Top2a A T 11: 99,012,148 C404* probably null Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Zcwpw1 T C 5: 137,810,807 probably benign Het
Zfhx4 A T 3: 5,401,073 H2097L probably damaging Het
Zfp874b T C 13: 67,474,712 K156E probably damaging Het
Zfyve16 T C 13: 92,493,878 K1413E possibly damaging Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85084638 splice site probably null
IGL00671:Man2b1 APN 8 85093938 missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85097430 missense probably benign 0.00
dateline UTSW 8 85084737 missense probably damaging 1.00
meridian UTSW 8 85096752 missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85097489 missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85093016 missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85096776 missense probably benign
R0837:Man2b1 UTSW 8 85096829 missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85095171 missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85086845 missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85093934 missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85086822 missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85095335 missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85085384 missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85093024 splice site probably benign
R3897:Man2b1 UTSW 8 85096948 splice site probably benign
R3971:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85084737 missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85090936 missense probably benign 0.22
R5183:Man2b1 UTSW 8 85095784 missense probably damaging 1.00
R5191:Man2b1 UTSW 8 85084459 missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85094210 missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85096752 missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85097046 missense probably benign 0.44
R6341:Man2b1 UTSW 8 85095399 missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85097447 missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85084479 missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85096853 missense probably benign 0.01
R6631:Man2b1 UTSW 8 85086811 unclassified probably null
R6828:Man2b1 UTSW 8 85086919 missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85091071 splice site probably null
R7159:Man2b1 UTSW 8 85087280 missense probably benign 0.09
R7267:Man2b1 UTSW 8 85087175 missense probably damaging 1.00
R7537:Man2b1 UTSW 8 85090965 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCGCACCTCTTCGTAAGTGTC -3'
(R):5'- CCACCCTTCTTTCCCAAGAATGGAC -3'

Sequencing Primer
(F):5'- TCGTAAGTGTCATCTGTTGACC -3'
(R):5'- TTTCCCAAGAATGGACCCCTC -3'
Posted On2014-05-23