Incidental Mutation 'R0727:Pbld2'
Institutional Source Beutler Lab
Gene Symbol Pbld2
Ensembl Gene ENSMUSG00000020072
Gene Namephenazine biosynthesis-like protein domain containing 2
MMRRC Submission 038909-MU
Accession Numbers

Genbank: NM_026085 ; MGI: 1914557

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0727 (G1)
Quality Score225
Status Validated
Chromosomal Location63024315-63058813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63067519 bp
Amino Acid Change Valine to Aspartic acid at position 125 (V125D)
Ref Sequence ENSEMBL: ENSMUSP00000136589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020266] [ENSMUST00000178684] [ENSMUST00000219045] [ENSMUST00000219687]
Predicted Effect probably benign
Transcript: ENSMUST00000020266
AA Change: V126D

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020266
Gene: ENSMUSG00000112129
AA Change: V126D

Pfam:PhzC-PhzF 8 285 7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178684
AA Change: V125D

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136589
Gene: ENSMUSG00000112129
AA Change: V125D

Pfam:PhzC-PhzF 8 284 2.6e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218401
Predicted Effect probably benign
Transcript: ENSMUST00000219045
Predicted Effect probably benign
Transcript: ENSMUST00000219687
Predicted Effect unknown
Transcript: ENSMUST00000219829
AA Change: V18D
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency 99% (70/71)
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A G 13: 98,984,227 V97A probably benign Het
2810474O19Rik A G 6: 149,325,822 N122S possibly damaging Het
Actr3b T C 5: 25,811,939 V83A possibly damaging Het
Adam2 A G 14: 66,029,731 I693T probably damaging Het
Adamts1 T C 16: 85,798,648 D214G possibly damaging Het
Atp6v1h T A 1: 5,084,558 Y36* probably null Het
Cacna1d A G 14: 30,130,115 probably null Het
Catsperb G T 12: 101,594,355 probably null Het
Ccdc88b T C 19: 6,854,214 M482V probably benign Het
Cemip T C 7: 83,961,578 K723E probably benign Het
Cep112 G A 11: 108,506,554 R375H probably damaging Het
Cpne7 T C 8: 123,126,286 S211P probably damaging Het
Csde1 A G 3: 103,043,638 T191A probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dlc1 A G 8: 36,572,674 V1027A probably damaging Het
Ergic2 T A 6: 148,199,400 probably benign Het
Evpl T C 11: 116,232,485 H307R probably damaging Het
Faah A G 4: 116,005,060 I242T probably damaging Het
Farsa T A 8: 84,861,304 probably null Het
Fat3 A C 9: 15,996,699 L2669R probably damaging Het
Fgfr4 C A 13: 55,156,228 probably null Het
Gnl3 A G 14: 31,017,077 S55P probably damaging Het
Grhl3 T A 4: 135,546,254 K562N possibly damaging Het
Hoxa9 A G 6: 52,224,314 V249A probably damaging Het
Hyal1 T C 9: 107,578,402 S304P possibly damaging Het
Igf1r T C 7: 68,212,158 probably null Het
Kif3c A G 12: 3,366,776 T266A probably benign Het
Lrp1b T C 2: 40,750,944 D3496G probably benign Het
Man2b1 T G 8: 85,091,526 V442G probably damaging Het
Mast1 T C 8: 84,921,415 Y479C probably damaging Het
Mei1 A G 15: 82,070,149 T52A probably benign Het
Micall1 A G 15: 79,120,778 D150G probably benign Het
Muc4 A G 16: 32,769,847 M2927V probably benign Het
Olfr1065 T C 2: 86,445,938 M15V probably benign Het
Olfr1082 A T 2: 86,594,380 Y149* probably null Het
Olfr1436 T C 19: 12,299,094 I13V probably benign Het
Olfr153 T A 2: 87,532,901 Y289* probably null Het
Olfr504 C T 7: 108,565,108 R229H probably benign Het
Olfr745 G T 14: 50,643,003 V241L probably damaging Het
Pabpc2 A C 18: 39,775,134 Q484P probably benign Het
Pkhd1l1 A G 15: 44,535,788 T2083A possibly damaging Het
Pum2 A G 12: 8,744,465 E785G probably damaging Het
Qser1 A G 2: 104,777,311 probably benign Het
R3hcc1l A G 19: 42,576,075 D29G probably damaging Het
Rabep1 T A 11: 70,900,492 Y180* probably null Het
Rassf5 T C 1: 131,181,265 S140G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T A 7: 5,115,293 I93L probably benign Het
Rnf219 G C 14: 104,480,188 L250V probably damaging Het
Ryr2 C T 13: 11,566,885 G4798D probably damaging Het
Scaf11 G A 15: 96,419,443 P747S probably damaging Het
Sgo2b T G 8: 63,927,782 K672T probably damaging Het
Smg1 T C 7: 118,166,422 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssh3 G T 19: 4,263,991 H439Q probably damaging Het
Steap3 T A 1: 120,227,817 T471S possibly damaging Het
Stk33 T A 7: 109,321,518 I208L probably damaging Het
Sucnr1 A G 3: 60,086,660 Y203C probably benign Het
Tlr11 T C 14: 50,361,469 I304T possibly damaging Het
Top2a A T 11: 99,012,148 C404* probably null Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Zcwpw1 T C 5: 137,810,807 probably benign Het
Zfhx4 A T 3: 5,401,073 H2097L probably damaging Het
Zfp874b T C 13: 67,474,712 K156E probably damaging Het
Zfyve16 T C 13: 92,493,878 K1413E possibly damaging Het
Other mutations in Pbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pbld2 APN 10 63071955 missense probably benign 0.01
IGL02162:Pbld2 APN 10 63071400 splice site probably benign
IGL03206:Pbld2 APN 10 63047482 missense probably benign 0.06
R0311:Pbld2 UTSW 10 63054507 critical splice donor site probably null
R0366:Pbld2 UTSW 10 63053957 unclassified probably benign
R0731:Pbld2 UTSW 10 63056811 missense probably damaging 1.00
R1412:Pbld2 UTSW 10 63047522 missense probably damaging 1.00
R1523:Pbld2 UTSW 10 63076433 missense probably benign 0.01
R1531:Pbld2 UTSW 10 63053953 critical splice donor site probably null
R1773:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1778:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1797:Pbld2 UTSW 10 63075124 critical splice donor site probably null
R2251:Pbld2 UTSW 10 63024605 unclassified probably benign
R3036:Pbld2 UTSW 10 63071446 missense probably damaging 1.00
R3117:Pbld2 UTSW 10 63054436 missense probably benign 0.00
R3622:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3624:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3734:Pbld2 UTSW 10 63071465 missense probably damaging 1.00
R4260:Pbld2 UTSW 10 63024407 unclassified probably benign
R4684:Pbld2 UTSW 10 63057697 missense probably damaging 1.00
R4928:Pbld2 UTSW 10 63047999 missense probably damaging 1.00
R4936:Pbld2 UTSW 10 63052238 missense probably damaging 1.00
R5508:Pbld2 UTSW 10 63066665 unclassified probably null
R5596:Pbld2 UTSW 10 63072012 missense probably damaging 1.00
R5603:Pbld2 UTSW 10 63071449 missense probably benign
R6298:Pbld2 UTSW 10 63039152 missense probably benign 0.05
R6404:Pbld2 UTSW 10 63054328 missense probably damaging 0.98
R7089:Pbld2 UTSW 10 63053912 missense probably benign 0.23
R7134:Pbld2 UTSW 10 63024589 unclassified probably benign
R7423:Pbld2 UTSW 10 63048004 missense probably damaging 1.00
R8016:Pbld2 UTSW 10 63047965 missense probably damaging 1.00
R8039:Pbld2 UTSW 10 63047992 missense probably damaging 1.00
R8119:Pbld2 UTSW 10 63053877 missense probably benign 0.34
YA93:Pbld2 UTSW 10 63054445 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cacacacacacacacacac -3'
Posted On2014-05-23