Incidental Mutation 'R0727:Dapk3'
ID200658
Institutional Source Beutler Lab
Gene Symbol Dapk3
Ensembl Gene ENSMUSG00000034974
Gene Namedeath-associated protein kinase 3
SynonymsZIP kinase
MMRRC Submission 038909-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0727 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81183005-81193197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81190262 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 129 (Y129C)
Ref Sequence ENSEMBL: ENSMUSP00000151577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133] [ENSMUST00000219850]
Predicted Effect probably damaging
Transcript: ENSMUST00000047665
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974
AA Change: Y129C

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150782
Predicted Effect probably damaging
Transcript: ENSMUST00000178422
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974
AA Change: Y129C

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217936
Predicted Effect probably damaging
Transcript: ENSMUST00000218157
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218698
Predicted Effect probably damaging
Transcript: ENSMUST00000219133
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219329
Predicted Effect probably damaging
Transcript: ENSMUST00000219850
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220076
Meta Mutation Damage Score 0.9140 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 3 (DAPK3) induces morphological changes in apoptosis when overexpressed in mammalian cells. These results suggest that DAPK3 may play a role in the induction of apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit embryonic lethality after blastocyst implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A G 13: 98,984,227 V97A probably benign Het
2810474O19Rik A G 6: 149,325,822 N122S possibly damaging Het
Actr3b T C 5: 25,811,939 V83A possibly damaging Het
Adam2 A G 14: 66,029,731 I693T probably damaging Het
Adamts1 T C 16: 85,798,648 D214G possibly damaging Het
Atp6v1h T A 1: 5,084,558 Y36* probably null Het
Cacna1d A G 14: 30,130,115 probably null Het
Catsperb G T 12: 101,594,355 probably null Het
Ccdc88b T C 19: 6,854,214 M482V probably benign Het
Cemip T C 7: 83,961,578 K723E probably benign Het
Cep112 G A 11: 108,506,554 R375H probably damaging Het
Cpne7 T C 8: 123,126,286 S211P probably damaging Het
Csde1 A G 3: 103,043,638 T191A probably benign Het
Dlc1 A G 8: 36,572,674 V1027A probably damaging Het
Ergic2 T A 6: 148,199,400 probably benign Het
Evpl T C 11: 116,232,485 H307R probably damaging Het
Faah A G 4: 116,005,060 I242T probably damaging Het
Farsa T A 8: 84,861,304 probably null Het
Fat3 A C 9: 15,996,699 L2669R probably damaging Het
Fgfr4 C A 13: 55,156,228 probably null Het
Gnl3 A G 14: 31,017,077 S55P probably damaging Het
Grhl3 T A 4: 135,546,254 K562N possibly damaging Het
Hoxa9 A G 6: 52,224,314 V249A probably damaging Het
Hyal1 T C 9: 107,578,402 S304P possibly damaging Het
Igf1r T C 7: 68,212,158 probably null Het
Kif3c A G 12: 3,366,776 T266A probably benign Het
Lrp1b T C 2: 40,750,944 D3496G probably benign Het
Man2b1 T G 8: 85,091,526 V442G probably damaging Het
Mast1 T C 8: 84,921,415 Y479C probably damaging Het
Mei1 A G 15: 82,070,149 T52A probably benign Het
Micall1 A G 15: 79,120,778 D150G probably benign Het
Muc4 A G 16: 32,769,847 M2927V probably benign Het
Olfr1065 T C 2: 86,445,938 M15V probably benign Het
Olfr1082 A T 2: 86,594,380 Y149* probably null Het
Olfr1436 T C 19: 12,299,094 I13V probably benign Het
Olfr153 T A 2: 87,532,901 Y289* probably null Het
Olfr504 C T 7: 108,565,108 R229H probably benign Het
Olfr745 G T 14: 50,643,003 V241L probably damaging Het
Pabpc2 A C 18: 39,775,134 Q484P probably benign Het
Pbld2 T A 10: 63,067,519 V125D probably benign Het
Pkhd1l1 A G 15: 44,535,788 T2083A possibly damaging Het
Pum2 A G 12: 8,744,465 E785G probably damaging Het
Qser1 A G 2: 104,777,311 probably benign Het
R3hcc1l A G 19: 42,576,075 D29G probably damaging Het
Rabep1 T A 11: 70,900,492 Y180* probably null Het
Rassf5 T C 1: 131,181,265 S140G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T A 7: 5,115,293 I93L probably benign Het
Rnf219 G C 14: 104,480,188 L250V probably damaging Het
Ryr2 C T 13: 11,566,885 G4798D probably damaging Het
Scaf11 G A 15: 96,419,443 P747S probably damaging Het
Sgo2b T G 8: 63,927,782 K672T probably damaging Het
Smg1 T C 7: 118,166,422 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssh3 G T 19: 4,263,991 H439Q probably damaging Het
Steap3 T A 1: 120,227,817 T471S possibly damaging Het
Stk33 T A 7: 109,321,518 I208L probably damaging Het
Sucnr1 A G 3: 60,086,660 Y203C probably benign Het
Tlr11 T C 14: 50,361,469 I304T possibly damaging Het
Top2a A T 11: 99,012,148 C404* probably null Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Zcwpw1 T C 5: 137,810,807 probably benign Het
Zfhx4 A T 3: 5,401,073 H2097L probably damaging Het
Zfp874b T C 13: 67,474,712 K156E probably damaging Het
Zfyve16 T C 13: 92,493,878 K1413E possibly damaging Het
Other mutations in Dapk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dapk3 APN 10 81184076 critical splice donor site probably null
IGL02076:Dapk3 APN 10 81190297 missense probably damaging 1.00
IGL02329:Dapk3 APN 10 81190165 missense probably benign 0.42
IGL02515:Dapk3 APN 10 81189929 splice site probably benign
IGL03002:Dapk3 APN 10 81190603 nonsense probably null
R0131:Dapk3 UTSW 10 81192307 missense probably benign 0.05
R1628:Dapk3 UTSW 10 81191809 missense possibly damaging 0.79
R5084:Dapk3 UTSW 10 81190318 splice site probably null
R5222:Dapk3 UTSW 10 81192460 missense probably damaging 0.98
R6112:Dapk3 UTSW 10 81184030 missense probably benign 0.43
R6799:Dapk3 UTSW 10 81190262 missense probably damaging 1.00
R6884:Dapk3 UTSW 10 81191754 splice site probably null
Z1177:Dapk3 UTSW 10 81191769 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAGCCAAGTTCATCAAGAAGCGG -3'
(R):5'- GTGCTTGTCCAGCAACATGATGTTC -3'

Sequencing Primer
(F):5'- AACGCGAGGTGAGCATCC -3'
(R):5'- CAACATGATGTTCTCGGGC -3'
Posted On2014-05-23