Incidental Mutation 'R0727:Pabpc2'
ID200686
Institutional Source Beutler Lab
Gene Symbol Pabpc2
Ensembl Gene ENSMUSG00000051732
Gene Namepoly(A) binding protein, cytoplasmic 2
SynonymsPabp2
MMRRC Submission 038909-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0727 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location39773497-39776082 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 39775134 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 484 (Q484P)
Ref Sequence ENSEMBL: ENSMUSP00000066639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063219]
Predicted Effect probably benign
Transcript: ENSMUST00000063219
AA Change: Q484P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066639
Gene: ENSMUSG00000051732
AA Change: Q484P

DomainStartEndE-ValueType
RRM 12 85 1.64e-19 SMART
RRM 100 171 7.57e-24 SMART
RRM 192 264 5.23e-27 SMART
RRM 295 366 3.53e-24 SMART
low complexity region 398 413 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
PolyA 546 609 1.69e-27 SMART
Meta Mutation Damage Score 0.0658 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A G 13: 98,984,227 V97A probably benign Het
2810474O19Rik A G 6: 149,325,822 N122S possibly damaging Het
Actr3b T C 5: 25,811,939 V83A possibly damaging Het
Adam2 A G 14: 66,029,731 I693T probably damaging Het
Adamts1 T C 16: 85,798,648 D214G possibly damaging Het
Atp6v1h T A 1: 5,084,558 Y36* probably null Het
Cacna1d A G 14: 30,130,115 probably null Het
Catsperb G T 12: 101,594,355 probably null Het
Ccdc88b T C 19: 6,854,214 M482V probably benign Het
Cemip T C 7: 83,961,578 K723E probably benign Het
Cep112 G A 11: 108,506,554 R375H probably damaging Het
Cpne7 T C 8: 123,126,286 S211P probably damaging Het
Csde1 A G 3: 103,043,638 T191A probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dlc1 A G 8: 36,572,674 V1027A probably damaging Het
Ergic2 T A 6: 148,199,400 probably benign Het
Evpl T C 11: 116,232,485 H307R probably damaging Het
Faah A G 4: 116,005,060 I242T probably damaging Het
Farsa T A 8: 84,861,304 probably null Het
Fat3 A C 9: 15,996,699 L2669R probably damaging Het
Fgfr4 C A 13: 55,156,228 probably null Het
Gnl3 A G 14: 31,017,077 S55P probably damaging Het
Grhl3 T A 4: 135,546,254 K562N possibly damaging Het
Hoxa9 A G 6: 52,224,314 V249A probably damaging Het
Hyal1 T C 9: 107,578,402 S304P possibly damaging Het
Igf1r T C 7: 68,212,158 probably null Het
Kif3c A G 12: 3,366,776 T266A probably benign Het
Lrp1b T C 2: 40,750,944 D3496G probably benign Het
Man2b1 T G 8: 85,091,526 V442G probably damaging Het
Mast1 T C 8: 84,921,415 Y479C probably damaging Het
Mei1 A G 15: 82,070,149 T52A probably benign Het
Micall1 A G 15: 79,120,778 D150G probably benign Het
Muc4 A G 16: 32,769,847 M2927V probably benign Het
Olfr1065 T C 2: 86,445,938 M15V probably benign Het
Olfr1082 A T 2: 86,594,380 Y149* probably null Het
Olfr1436 T C 19: 12,299,094 I13V probably benign Het
Olfr153 T A 2: 87,532,901 Y289* probably null Het
Olfr504 C T 7: 108,565,108 R229H probably benign Het
Olfr745 G T 14: 50,643,003 V241L probably damaging Het
Pbld2 T A 10: 63,067,519 V125D probably benign Het
Pkhd1l1 A G 15: 44,535,788 T2083A possibly damaging Het
Pum2 A G 12: 8,744,465 E785G probably damaging Het
Qser1 A G 2: 104,777,311 probably benign Het
R3hcc1l A G 19: 42,576,075 D29G probably damaging Het
Rabep1 T A 11: 70,900,492 Y180* probably null Het
Rassf5 T C 1: 131,181,265 S140G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rfpl4 T A 7: 5,115,293 I93L probably benign Het
Rnf219 G C 14: 104,480,188 L250V probably damaging Het
Ryr2 C T 13: 11,566,885 G4798D probably damaging Het
Scaf11 G A 15: 96,419,443 P747S probably damaging Het
Sgo2b T G 8: 63,927,782 K672T probably damaging Het
Smg1 T C 7: 118,166,422 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssh3 G T 19: 4,263,991 H439Q probably damaging Het
Steap3 T A 1: 120,227,817 T471S possibly damaging Het
Stk33 T A 7: 109,321,518 I208L probably damaging Het
Sucnr1 A G 3: 60,086,660 Y203C probably benign Het
Tlr11 T C 14: 50,361,469 I304T possibly damaging Het
Top2a A T 11: 99,012,148 C404* probably null Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Zcwpw1 T C 5: 137,810,807 probably benign Het
Zfhx4 A T 3: 5,401,073 H2097L probably damaging Het
Zfp874b T C 13: 67,474,712 K156E probably damaging Het
Zfyve16 T C 13: 92,493,878 K1413E possibly damaging Het
Other mutations in Pabpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Pabpc2 APN 18 39775337 missense possibly damaging 0.78
IGL01295:Pabpc2 APN 18 39774029 missense probably damaging 1.00
IGL02061:Pabpc2 APN 18 39774993 missense probably benign 0.01
IGL02104:Pabpc2 APN 18 39774883 missense possibly damaging 0.65
IGL02513:Pabpc2 APN 18 39775140 missense probably benign 0.08
R0201:Pabpc2 UTSW 18 39775307 missense probably benign 0.01
R0383:Pabpc2 UTSW 18 39775395 missense probably damaging 0.99
R0616:Pabpc2 UTSW 18 39773739 missense possibly damaging 0.94
R1597:Pabpc2 UTSW 18 39773900 missense probably damaging 1.00
R1722:Pabpc2 UTSW 18 39775116 missense probably benign 0.08
R1818:Pabpc2 UTSW 18 39774110 missense probably damaging 1.00
R2230:Pabpc2 UTSW 18 39775070 missense probably benign 0.00
R3087:Pabpc2 UTSW 18 39774266 missense probably benign 0.02
R4080:Pabpc2 UTSW 18 39775530 missense possibly damaging 0.86
R4332:Pabpc2 UTSW 18 39775340 missense probably benign 0.05
R4386:Pabpc2 UTSW 18 39775185 missense probably benign 0.00
R4445:Pabpc2 UTSW 18 39774200 missense probably damaging 1.00
R4718:Pabpc2 UTSW 18 39774503 missense probably benign
R4744:Pabpc2 UTSW 18 39774828 missense probably benign 0.07
R4748:Pabpc2 UTSW 18 39774269 nonsense probably null
R5085:Pabpc2 UTSW 18 39774582 missense probably damaging 1.00
R5113:Pabpc2 UTSW 18 39775383 missense probably benign 0.16
R5994:Pabpc2 UTSW 18 39773894 missense probably benign 0.18
R6216:Pabpc2 UTSW 18 39774719 missense probably damaging 1.00
R6239:Pabpc2 UTSW 18 39773838 missense probably damaging 1.00
R6355:Pabpc2 UTSW 18 39774392 missense probably damaging 0.97
R7221:Pabpc2 UTSW 18 39773910 missense possibly damaging 0.52
X0024:Pabpc2 UTSW 18 39775397 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCTCAACCAAGGCCAAGTGCTC -3'
(R):5'- CAGCAACATGCCCGTGATCTTACC -3'

Sequencing Primer
(F):5'- CAAGTGCTCGCTGGATTGC -3'
(R):5'- GTGATCTTACCAGCCAGAGTC -3'
Posted On2014-05-23