Incidental Mutation 'R0089:Scap'
ID20073
Institutional Source Beutler Lab
Gene Symbol Scap
Ensembl Gene ENSMUSG00000032485
Gene NameSREBF chaperone
Synonyms
MMRRC Submission 038376-MU
Accession Numbers

Genbank: NM_001001144; MGI: 2135958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0089 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location110333288-110384950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110372222 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 93 (I93T)
Ref Sequence ENSEMBL: ENSMUSP00000143369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098350] [ENSMUST00000197630] [ENSMUST00000198976]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098350
AA Change: I93T

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485
AA Change: I93T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196775
Predicted Effect probably benign
Transcript: ENSMUST00000197630
AA Change: I93T

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142919
Gene: ENSMUSG00000032485
AA Change: I93T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198976
AA Change: I93T

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143369
Gene: ENSMUSG00000032485
AA Change: I93T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199886
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, other(1) Gene trapped(22)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Scap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Scap APN 9 110376631 missense probably damaging 1.00
IGL01012:Scap APN 9 110362420 missense probably damaging 1.00
IGL01487:Scap APN 9 110377734 critical splice donor site probably null
IGL01634:Scap APN 9 110378789 critical splice donor site probably null
IGL01725:Scap APN 9 110381554 unclassified probably benign
IGL01939:Scap APN 9 110379481 missense probably benign 0.02
IGL02106:Scap APN 9 110381656 unclassified probably benign
IGL02423:Scap APN 9 110378617 missense probably benign 0.02
IGL02487:Scap APN 9 110378690 missense probably benign 0.19
IGL02545:Scap APN 9 110378690 missense probably benign 0.19
IGL03226:Scap APN 9 110384267 missense possibly damaging 0.93
IGL03331:Scap APN 9 110380236 unclassified probably null
3-1:Scap UTSW 9 110372968 intron probably benign
R0027:Scap UTSW 9 110379730 missense probably benign 0.06
R0742:Scap UTSW 9 110381259 missense probably damaging 1.00
R1416:Scap UTSW 9 110384773 missense probably damaging 1.00
R1785:Scap UTSW 9 110374055 missense probably damaging 0.97
R1996:Scap UTSW 9 110372971 intron probably benign
R2114:Scap UTSW 9 110381273 missense probably damaging 0.99
R2189:Scap UTSW 9 110377693 missense probably damaging 1.00
R2233:Scap UTSW 9 110381593 missense probably damaging 0.98
R2234:Scap UTSW 9 110381593 missense probably damaging 0.98
R2656:Scap UTSW 9 110374019 missense probably damaging 1.00
R3176:Scap UTSW 9 110374025 missense probably benign
R3237:Scap UTSW 9 110379582 missense probably damaging 0.96
R3276:Scap UTSW 9 110374025 missense probably benign
R3623:Scap UTSW 9 110380203 missense probably damaging 0.99
R3826:Scap UTSW 9 110381297 missense probably benign
R4859:Scap UTSW 9 110374342 unclassified probably benign
R4993:Scap UTSW 9 110378390 missense probably damaging 1.00
R5052:Scap UTSW 9 110353152 missense possibly damaging 0.89
R5330:Scap UTSW 9 110381633 missense probably benign 0.00
R5331:Scap UTSW 9 110381633 missense probably benign 0.00
R5383:Scap UTSW 9 110374529 missense probably damaging 0.99
R5410:Scap UTSW 9 110374182 unclassified probably null
R5531:Scap UTSW 9 110381429 missense possibly damaging 0.59
R5567:Scap UTSW 9 110377644 missense probably damaging 1.00
R5636:Scap UTSW 9 110380594 missense probably damaging 0.99
R5637:Scap UTSW 9 110381572 missense possibly damaging 0.94
R5859:Scap UTSW 9 110374047 missense probably benign 0.14
R5923:Scap UTSW 9 110383580 missense probably damaging 0.98
R5945:Scap UTSW 9 110384596 missense probably benign 0.00
R5987:Scap UTSW 9 110381151 missense probably damaging 1.00
R6075:Scap UTSW 9 110378777 missense probably damaging 1.00
R6130:Scap UTSW 9 110380379 missense possibly damaging 0.95
R6190:Scap UTSW 9 110374067 missense probably benign 0.01
R6567:Scap UTSW 9 110383562 missense probably damaging 1.00
R6999:Scap UTSW 9 110384647 missense probably damaging 1.00
R7098:Scap UTSW 9 110372242 missense possibly damaging 0.89
R7386:Scap UTSW 9 110373169 missense probably benign 0.00
R7642:Scap UTSW 9 110374013 missense probably damaging 1.00
X0064:Scap UTSW 9 110377645 missense probably damaging 1.00
Z1088:Scap UTSW 9 110372336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCTGGTAAAGGGCTAGACAG -3'
(R):5'- CCAAGGAGAACTGCAAAGCTGACTG -3'

Sequencing Primer
(F):5'- GCTTGGTAGTATGATAGACCAGAC -3'
(R):5'- AGCTGACTGATAATGTAACTCCC -3'
Posted On2013-04-11