Incidental Mutation 'R1411:Gm1527'
ID200791
Institutional Source Beutler Lab
Gene Symbol Gm1527
Ensembl Gene ENSMUSG00000074655
Gene Namepredicted gene 1527
SynonymsLOC385263
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28892617-28926724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28914483 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 228 (N228S)
Ref Sequence ENSEMBL: ENSMUSP00000096773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099170]
Predicted Effect probably benign
Transcript: ENSMUST00000099170
AA Change: N228S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096773
Gene: ENSMUSG00000074655
AA Change: N228S

DomainStartEndE-ValueType
PH 16 119 2.37e-6 SMART
Pfam:RA 125 214 1.7e-8 PFAM
RhoGAP 300 471 2.8e-29 SMART
transmembrane domain 623 645 N/A INTRINSIC
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Gm1527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Gm1527 APN 3 28895588 utr 5 prime probably benign
IGL02069:Gm1527 APN 3 28926614 missense possibly damaging 0.53
IGL02794:Gm1527 APN 3 28895680 missense unknown
IGL03285:Gm1527 APN 3 28920417 missense probably damaging 1.00
PIT4403001:Gm1527 UTSW 3 28917985 missense possibly damaging 0.82
R0316:Gm1527 UTSW 3 28915774 missense probably damaging 1.00
R0487:Gm1527 UTSW 3 28926679 missense probably benign 0.00
R1458:Gm1527 UTSW 3 28918050 missense possibly damaging 0.52
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1470:Gm1527 UTSW 3 28915268 missense possibly damaging 0.82
R1476:Gm1527 UTSW 3 28926556 missense probably benign 0.19
R1523:Gm1527 UTSW 3 28920418 missense probably damaging 1.00
R1613:Gm1527 UTSW 3 28898853 critical splice donor site probably null
R1649:Gm1527 UTSW 3 28898731 missense probably damaging 1.00
R1722:Gm1527 UTSW 3 28921634 missense probably benign 0.10
R1760:Gm1527 UTSW 3 28895550 splice site probably benign
R1857:Gm1527 UTSW 3 28903390 missense probably damaging 0.99
R1981:Gm1527 UTSW 3 28915835 critical splice donor site probably null
R2063:Gm1527 UTSW 3 28926647 missense probably benign 0.04
R2080:Gm1527 UTSW 3 28926661 missense probably benign 0.01
R2115:Gm1527 UTSW 3 28917949 missense probably benign 0.00
R2440:Gm1527 UTSW 3 28895615 missense probably damaging 0.98
R3799:Gm1527 UTSW 3 28926596 missense possibly damaging 0.53
R4012:Gm1527 UTSW 3 28898820 missense probably benign 0.04
R4132:Gm1527 UTSW 3 28920630 missense probably benign 0.37
R4234:Gm1527 UTSW 3 28914366 missense probably damaging 1.00
R4406:Gm1527 UTSW 3 28895725 missense possibly damaging 0.81
R4528:Gm1527 UTSW 3 28914393 missense probably damaging 0.99
R4567:Gm1527 UTSW 3 28914407 missense probably damaging 0.99
R4795:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R4796:Gm1527 UTSW 3 28920663 missense possibly damaging 0.56
R5127:Gm1527 UTSW 3 28903418 missense probably damaging 1.00
R5774:Gm1527 UTSW 3 28918090 missense probably benign 0.22
R5890:Gm1527 UTSW 3 28915395 missense probably benign 0.03
R6024:Gm1527 UTSW 3 28920603 missense probably benign 0.10
R7092:Gm1527 UTSW 3 28914547 critical splice donor site probably null
R7128:Gm1527 UTSW 3 28915311 missense possibly damaging 0.95
R7197:Gm1527 UTSW 3 28926541 missense probably null 0.00
R7308:Gm1527 UTSW 3 28902280 missense probably benign 0.02
R7360:Gm1527 UTSW 3 28914542 nonsense probably null
R7380:Gm1527 UTSW 3 28920472 missense probably benign 0.10
R7566:Gm1527 UTSW 3 28920618 missense probably benign 0.02
X0021:Gm1527 UTSW 3 28920468 missense probably damaging 1.00
X0028:Gm1527 UTSW 3 28914500 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCTAAAGCCCATTGGAAGGGTTG -3'
(R):5'- TCAAGCTGGACCTGGGGCATATTG -3'

Sequencing Primer
(F):5'- AAGGGTTGCTCAGTCTCATC -3'
(R):5'- GTTTTGGTGTGTTTCCTACAATTCC -3'
Posted On2014-05-23