Mutagenetix > Incidental Mutation

Incidental Mutation 'R1411:Pdzrn4'

200827

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

039467-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R1411 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 92771013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 1015 (*1015W)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably null
Transcript: ENSMUST00000035399
AA Change: *776W

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: *776W

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000169942
AA Change: *1015W

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: *1015W

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.8532

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

100% (46/46)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	T	A	8: 71,461,730	I85F	probably damaging	Het
Acp4	A	G	7: 44,256,843		probably benign	Het
Baz1b	T	C	5: 135,230,323	F1080L	possibly damaging	Het
Cbx5	A	T	15: 103,213,120	M30K	probably benign	Het
Cdc73	A	G	1: 143,609,514		probably benign	Het
Cdcp1	A	T	9: 123,190,112	L34Q	probably damaging	Het
Chd8	C	T	14: 52,224,646	V738I	probably benign	Het
Cpeb2	T	G	5: 43,233,770		probably benign	Het
Cyp2c67	T	A	19: 39,638,591	D265V	probably damaging	Het
Cyp2j11	A	G	4: 96,345,216	I81T	probably benign	Het
Dbx2	T	C	15: 95,632,381	E235G	probably damaging	Het
Dgkq	C	A	5: 108,650,362	V677F	probably damaging	Het
Ercc5	A	G	1: 44,178,281	N928S	probably damaging	Het
Flt1	C	T	5: 147,580,316	V1054M	probably damaging	Het
Flywch1	T	C	17: 23,755,824	D614G	probably damaging	Het
Frmd3	T	C	4: 74,153,621	F247L	probably damaging	Het
Gm1527	A	G	3: 28,914,483	N228S	probably benign	Het
Gm8979	C	T	7: 106,083,479	A190T	probably benign	Het
Gpld1	T	A	13: 24,962,808	L251Q	probably damaging	Het
Gzma	C	T	13: 113,096,208	V117I	probably benign	Het
Hydin	C	A	8: 110,575,031	T3798K	probably benign	Het
Il1rapl1	T	A	X: 86,747,298	S679C	possibly damaging	Het
Lrrc8c	G	A	5: 105,608,179	A607T	probably damaging	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Mfsd4b4	A	T	10: 39,892,140	M319K	probably damaging	Het
Mroh2b	A	C	15: 4,918,317	H538P	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nup188	A	G	2: 30,343,795	T1733A	probably benign	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Ofcc1	A	G	13: 40,142,787	S524P	probably benign	Het
Olfr986	C	T	9: 40,187,139	T8I	possibly damaging	Het
Padi4	C	T	4: 140,752,603	S413N	probably damaging	Het
Pkhd1	G	A	1: 20,373,896	P2314L	probably damaging	Het
Serpinb9c	C	G	13: 33,151,834	V212L	probably benign	Het
Slc25a23	A	G	17: 57,059,622	F18L	probably damaging	Het
Smarca4	C	A	9: 21,658,955	N751K	probably damaging	Het
Tfip11	G	T	5: 112,333,033	V292L	probably benign	Het
Tnrc18	T	C	5: 142,765,947	K1201R	unknown	Het
Vmn1r199	T	C	13: 22,383,501	F322L	probably benign	Het
Vmn1r201	T	C	13: 22,474,679	V21A	probably benign	Het
Vmn2r108	A	T	17: 20,462,845	I699K	probably damaging	Het
Vmn2r117	T	C	17: 23,460,553	N566D	probably damaging	Het
Wdr12	A	T	1: 60,088,072	D141E	probably benign	Het
Zfp974	A	G	7: 27,911,209	S364P	probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGCTGAGCATCATCGAACTGAGCC -3'
(R):5'- CTGTGCCAGGAGGTAAAGCATAGAC -3'

Sequencing Primer
(F):5'- TCGAACTGAGCCACAAAAAGATG -3'
(R):5'- CCACATTGAACGAGGCAATG -3'

Posted On

2014-05-23