Incidental Mutation 'R0089:Sez6'
ID20083
Institutional Source Beutler Lab
Gene Symbol Sez6
Ensembl Gene ENSMUSG00000000632
Gene Nameseizure related gene 6
SynonymsD11Bhm177e, sez-6
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R0089 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77930800-77979048 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 77974344 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]
Predicted Effect probably benign
Transcript: ENSMUST00000000646
SMART Domains Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 910 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093995
SMART Domains Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126866
Predicted Effect probably benign
Transcript: ENSMUST00000140630
SMART Domains Protein: ENSMUSP00000115660
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
CUB 29 140 9.8e-28 SMART
CCP 157 214 5.43e-12 SMART
Pfam:CUB 218 278 1.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142542
Predicted Effect probably benign
Transcript: ENSMUST00000151982
SMART Domains Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
CUB 75 184 9.36e-2 SMART
CCP 188 243 1.23e-10 SMART
CUB 247 358 8.08e-29 SMART
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155087
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Slc22a30 A T 19: 8,370,197 S280T probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Sez6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Sez6 APN 11 77977289 splice site probably benign
IGL01142:Sez6 APN 11 77973816 missense probably damaging 1.00
IGL02252:Sez6 APN 11 77974513 missense probably damaging 1.00
IGL02332:Sez6 APN 11 77954742 splice site probably benign
IGL02366:Sez6 APN 11 77976882 missense probably damaging 0.98
IGL02479:Sez6 APN 11 77978026 missense possibly damaging 0.84
IGL02963:Sez6 APN 11 77962949 missense possibly damaging 0.93
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0485:Sez6 UTSW 11 77953813 missense probably damaging 1.00
R0598:Sez6 UTSW 11 77977821 missense possibly damaging 0.88
R0729:Sez6 UTSW 11 77976585 missense probably benign 0.01
R1117:Sez6 UTSW 11 77974514 missense probably damaging 1.00
R1199:Sez6 UTSW 11 77953885 missense probably benign
R1534:Sez6 UTSW 11 77963045 missense probably damaging 1.00
R1835:Sez6 UTSW 11 77953503 missense probably benign
R1840:Sez6 UTSW 11 77953717 missense possibly damaging 0.79
R1929:Sez6 UTSW 11 77972932 missense probably damaging 1.00
R1970:Sez6 UTSW 11 77954068 critical splice donor site probably null
R3156:Sez6 UTSW 11 77953779 missense possibly damaging 0.63
R3930:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R3931:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R4894:Sez6 UTSW 11 77975260 missense probably damaging 1.00
R4904:Sez6 UTSW 11 77975254 missense probably damaging 1.00
R5026:Sez6 UTSW 11 77968989 missense probably damaging 1.00
R5040:Sez6 UTSW 11 77969089 critical splice donor site probably null
R5057:Sez6 UTSW 11 77973153 missense probably damaging 1.00
R5093:Sez6 UTSW 11 77976562 missense possibly damaging 0.88
R5640:Sez6 UTSW 11 77973759 intron probably benign
R6013:Sez6 UTSW 11 77973797 missense probably damaging 1.00
R6126:Sez6 UTSW 11 77973804 missense probably damaging 1.00
R6153:Sez6 UTSW 11 77977822 missense probably damaging 0.99
R6279:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6300:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6475:Sez6 UTSW 11 77973844
R6722:Sez6 UTSW 11 77953702 missense probably damaging 1.00
R6897:Sez6 UTSW 11 77953559 missense probably damaging 1.00
R6910:Sez6 UTSW 11 77953869 missense possibly damaging 0.85
R7012:Sez6 UTSW 11 77977795 missense probably benign 0.04
R7233:Sez6 UTSW 11 77973137 missense probably damaging 1.00
R7265:Sez6 UTSW 11 77962865 missense probably damaging 0.96
R7289:Sez6 UTSW 11 77974323 missense possibly damaging 0.96
R7405:Sez6 UTSW 11 77962891 missense probably benign 0.10
R7408:Sez6 UTSW 11 77953530 missense probably damaging 1.00
R7485:Sez6 UTSW 11 77973885 missense probably benign 0.01
R7592:Sez6 UTSW 11 77978050 missense probably damaging 0.99
R7778:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R7793:Sez6 UTSW 11 77977600 missense probably damaging 1.00
R7818:Sez6 UTSW 11 77976902 missense probably damaging 1.00
R7824:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R8008:Sez6 UTSW 11 77973256 nonsense probably null
X0013:Sez6 UTSW 11 77954780 missense probably benign 0.01
X0067:Sez6 UTSW 11 77974438 critical splice acceptor site probably null
Z1088:Sez6 UTSW 11 77973197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACAAGCAGGGTAGGTCCCTAGTG -3'
(R):5'- TGTGAGGTCATCCCCATCGTAGAAG -3'

Sequencing Primer
(F):5'- GCCACAGCTCAGTGTGATTG -3'
(R):5'- TCGTAGAAGGTCAGTACATCCC -3'
Posted On2013-04-11