Incidental Mutation 'R1411:Vmn2r108'
ID200830
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Namevomeronasal 2, receptor 108
SynonymsEG627805
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20462373-20481236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20462845 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 699 (I699K)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
Predicted Effect probably damaging
Transcript: ENSMUST00000167314
AA Change: I699K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: I699K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20462512 missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20462465 missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20462677 nonsense probably null
IGL01411:Vmn2r108 APN 17 20471020 missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20471680 missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20463281 missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20463214 missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20471018 missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20471725 missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20463136 missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20471346 missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20469143 missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20471283 missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20471057 nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20463017 missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20471635 missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20462834 missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20471459 missense probably benign
R0836:Vmn2r108 UTSW 17 20471459 missense probably benign
R0943:Vmn2r108 UTSW 17 20471135 nonsense probably null
R1442:Vmn2r108 UTSW 17 20472361 nonsense probably null
R1587:Vmn2r108 UTSW 17 20472121 missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20462524 missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20469073 missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20470990 missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20469101 missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2226:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2517:Vmn2r108 UTSW 17 20472315 missense probably damaging 1.00
R3710:Vmn2r108 UTSW 17 20462670 missense probably benign
R4470:Vmn2r108 UTSW 17 20462728 missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20471374 missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20472370 missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20462629 missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20481187 missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20470192 missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20471493 missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20471604 missense probably damaging 1.00
R5290:Vmn2r108 UTSW 17 20471403 missense probably benign 0.00
R5713:Vmn2r108 UTSW 17 20471028 missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20462917 missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20463136 missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20472283 missense probably benign 0.39
R5897:Vmn2r108 UTSW 17 20471318 missense probably benign 0.01
R6018:Vmn2r108 UTSW 17 20463006 missense possibly damaging 0.83
R6093:Vmn2r108 UTSW 17 20481140 missense probably benign 0.00
R6156:Vmn2r108 UTSW 17 20472185 missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20462382 missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20463109 missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20471398 missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20471715 nonsense probably null
R6364:Vmn2r108 UTSW 17 20470998 missense probably benign 0.00
R6446:Vmn2r108 UTSW 17 20472347 nonsense probably null
R6541:Vmn2r108 UTSW 17 20481218 missense probably benign 0.02
R7025:Vmn2r108 UTSW 17 20471083 missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20481148 missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20481076 missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20462500 missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20462776 missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20472270 missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20472195 missense probably benign 0.02
X0022:Vmn2r108 UTSW 17 20471109 missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20471113 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCAAGGAGCATAGGTATCCCAG -3'
(R):5'- CAGAGACACTCCCATTGTGAAAGCC -3'

Sequencing Primer
(F):5'- CATAGGTATCCCAGAACACAGTGG -3'
(R):5'- CTCCCATTGTGAAAGCCAATAATAG -3'
Posted On2014-05-23