Incidental Mutation 'R1185:Lmod1'
ID200840
Institutional Source Beutler Lab
Gene Symbol Lmod1
Ensembl Gene ENSMUSG00000048096
Gene Nameleiomodin 1 (smooth muscle)
SynonymsD1, 9530015K06Rik, 64kD D1, 1D, SM-Lmod
MMRRC Submission 039257-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1185 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135324807-135368065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135364229 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 274 (D274G)
Ref Sequence ENSEMBL: ENSMUSP00000061597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059352]
Predicted Effect probably benign
Transcript: ENSMUST00000059352
AA Change: D274G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061597
Gene: ENSMUSG00000048096
AA Change: D274G

DomainStartEndE-ValueType
Pfam:Tropomodulin 5 127 1e-19 PFAM
low complexity region 177 190 N/A INTRINSIC
low complexity region 202 220 N/A INTRINSIC
PDB:1IO0|A 296 467 5e-35 PDB
SCOP:d1a4ya_ 311 445 7e-5 SMART
low complexity region 469 483 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
WH2 569 588 1.05e-3 SMART
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The leiomodin 1 protein has a putative membrane-spanning region and 2 types of tandemly repeated blocks. The transcript is expressed in all tissues tested, with the highest levels in thyroid, eye muscle, skeletal muscle, and ovary. Increased expression of leiomodin 1 may be linked to Graves' disease and thyroid-associated ophthalmopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ac165356.1 C T 7: 106,083,479 A190T probably benign Het
AC211878.1 A G 12: 87,773,708 V27A probably benign Het
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Arhgef25 A G 10: 127,183,781 F430L possibly damaging Het
Brap T C 5: 121,675,279 V235A probably damaging Het
Cd69 C T 6: 129,270,185 G23D probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Dusp13 A G 14: 21,735,018 F141S probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Focad A G 4: 88,178,187 T269A probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lrrn2 A G 1: 132,939,221 S675G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Muc19 A G 15: 91,878,549 noncoding transcript Het
Myo16 T A 8: 10,633,624 S1856T probably damaging Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Pgap3 T C 11: 98,391,134 D117G probably damaging Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Purg T G 8: 33,386,869 Y178* probably null Het
Rsph10b G A 5: 143,966,462 probably benign Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Trpm3 G A 19: 22,914,417 probably benign Het
Ttc30a1 A T 2: 75,980,352 N462K probably damaging Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Zfp459 T G 13: 67,408,481 N161T probably benign Het
Other mutations in Lmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Lmod1 APN 1 135364478 missense probably benign 0.05
IGL01104:Lmod1 APN 1 135364784 missense probably damaging 1.00
IGL02606:Lmod1 APN 1 135364480 missense probably benign 0.09
IGL03373:Lmod1 APN 1 135364526 missense possibly damaging 0.90
R0513:Lmod1 UTSW 1 135325168 missense probably damaging 0.98
R1185:Lmod1 UTSW 1 135364229 missense probably benign
R1185:Lmod1 UTSW 1 135364229 missense probably benign
R1572:Lmod1 UTSW 1 135363933 missense probably benign 0.00
R1728:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1729:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1730:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1739:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1762:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1783:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1784:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1785:Lmod1 UTSW 1 135364073 missense probably benign 0.10
R1795:Lmod1 UTSW 1 135325124 missense probably damaging 1.00
R2044:Lmod1 UTSW 1 135364387 missense probably benign 0.00
R2355:Lmod1 UTSW 1 135364515 missense probably benign 0.28
R2568:Lmod1 UTSW 1 135363964 nonsense probably null
R2937:Lmod1 UTSW 1 135363916 missense probably benign 0.11
R2938:Lmod1 UTSW 1 135363916 missense probably benign 0.11
R6108:Lmod1 UTSW 1 135364111 missense probably benign 0.43
R6823:Lmod1 UTSW 1 135325167 missense probably damaging 0.98
R6872:Lmod1 UTSW 1 135365141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTTTTAAAGAAAAGCTTCTCCAGGG -3'
(R):5'- GCAGTCTGAGTTGTTGACGTTCACC -3'

Sequencing Primer
(F):5'- AAGCTTCTCCAGGGATCGAG -3'
(R):5'- CTCTGTCATCTCTGGGTCGTTG -3'
Posted On2014-05-23