Incidental Mutation 'R1185:Focad'
ID200846
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
MMRRC Submission 039257-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R1185 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88178187 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 269 (T269A)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: T269A
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: T269A

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159342
AA Change: T269A

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: T269A

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161058
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ac165356.1 C T 7: 106,083,479 A190T probably benign Het
AC211878.1 A G 12: 87,773,708 V27A probably benign Het
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Arhgef25 A G 10: 127,183,781 F430L possibly damaging Het
Brap T C 5: 121,675,279 V235A probably damaging Het
Cd69 C T 6: 129,270,185 G23D probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Dusp13 A G 14: 21,735,018 F141S probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lmod1 A G 1: 135,364,229 D274G probably benign Het
Lrrn2 A G 1: 132,939,221 S675G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Muc19 A G 15: 91,878,549 noncoding transcript Het
Myo16 T A 8: 10,633,624 S1856T probably damaging Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Pgap3 T C 11: 98,391,134 D117G probably damaging Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Purg T G 8: 33,386,869 Y178* probably null Het
Rsph10b G A 5: 143,966,462 probably benign Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Trpm3 G A 19: 22,914,417 probably benign Het
Ttc30a1 A T 2: 75,980,352 N462K probably damaging Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Zfp459 T G 13: 67,408,481 N161T probably benign Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
Microscope UTSW 4 88342204 missense unknown
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
R7427:Focad UTSW 4 88368751 missense unknown
R7582:Focad UTSW 4 88229378 missense probably benign 0.00
R7661:Focad UTSW 4 88303535 missense unknown
R7688:Focad UTSW 4 88178133 missense probably damaging 1.00
R7789:Focad UTSW 4 88229406 missense unknown
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGTGTGAGACAAGAGCAGCCGA -3'
(R):5'- ACCACCCAGTTCCTCAAAGACTTTCTAA -3'

Sequencing Primer
(F):5'- aggggggaaaggagaagg -3'
(R):5'- AAGTGATAATGAGCACATTAACACG -3'
Posted On2014-05-23