Mutagenetix > Incidental Mutation

Incidental Mutation 'R1185:Tcaf3'

200851

Institutional Source

Beutler Lab

Gene Symbol

Tcaf3

Ensembl Gene

ENSMUSG00000018656

Gene Name

TRPM8 channel-associated factor 3

Synonyms

Eapa2, Fam115e

MMRRC Submission

039257-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R1185 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42584866-42597692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42591434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 663 (T663A)

Ref Sequence

ENSEMBL: ENSMUSP00000064060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]

AlphaFold

Q6QR59

Predicted Effect

probably damaging
Transcript: ENSMUST00000069023
AA Change: T663A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: T663A

Domain	Start	End	E-Value	Type
internal_repeat_1	26	194	9.98e-16	PROSPERO
low complexity region	210	221	N/A	INTRINSIC
internal_repeat_1	234	402	9.98e-16	PROSPERO
low complexity region	509	518	N/A	INTRINSIC
M60-like	533	832	3.49e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134707

SMART Domains

Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

Domain	Start	End	E-Value	Type
low complexity region	210	221	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151898

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

96% (45/47)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ac165356.1	C	T	7: 106,083,479	A190T	probably benign	Het
AC211878.1	A	G	12: 87,773,708	V27A	probably benign	Het
Aimp2	A	G	5: 143,904,691	S110P	possibly damaging	Het
Akap9	A	G	5: 3,948,783	T51A	probably benign	Het
Arhgef25	A	G	10: 127,183,781	F430L	possibly damaging	Het
Brap	T	C	5: 121,675,279	V235A	probably damaging	Het
Cd69	C	T	6: 129,270,185	G23D	probably damaging	Het
Cecr2	C	T	6: 120,758,205	R24*	probably null	Het
Celsr2	T	C	3: 108,399,709	D1974G	possibly damaging	Het
Cps1	A	G	1: 67,195,199	K915R	probably benign	Het
Csmd1	T	C	8: 16,358,348	D401G	probably damaging	Het
Dusp13	A	G	14: 21,735,018	F141S	probably damaging	Het
Fam162b	A	G	10: 51,590,343	W27R	probably benign	Het
Focad	A	G	4: 88,178,187	T269A	probably benign	Het
Ghr	T	A	15: 3,328,062	R241S	possibly damaging	Het
Hirip3	AAGAG	AAG	7: 126,863,660		probably null	Het
Itgb2l	A	G	16: 96,429,040	Y357H	possibly damaging	Het
Jrkl	T	C	9: 13,244,933	D241G	possibly damaging	Het
Lmod1	A	G	1: 135,364,229	D274G	probably benign	Het
Lrrn2	A	G	1: 132,939,221	S675G	probably benign	Het
Ltbp4	G	C	7: 27,310,535	P1200R	probably damaging	Het
Mdn1	T	C	4: 32,735,576	L3414P	possibly damaging	Het
Muc19	A	G	15: 91,878,549		noncoding transcript	Het
Myo16	T	A	8: 10,633,624	S1856T	probably damaging	Het
Neb	A	G	2: 52,296,298	Y921H	probably damaging	Het
Olfr135	T	A	17: 38,209,183	*313R	probably null	Het
Pgap3	T	C	11: 98,391,134	D117G	probably damaging	Het
Ppp1r9b	T	C	11: 95,001,986	F671L	possibly damaging	Het
Purg	T	G	8: 33,386,869	Y178*	probably null	Het
Rsph10b	G	A	5: 143,966,462		probably benign	Het
Sorbs1	T	A	19: 40,382,606	D79V	probably damaging	Het
Timd4	C	A	11: 46,817,648	T167K	probably damaging	Het
Tjp2	A	G	19: 24,131,163	L195P	possibly damaging	Het
Tnr	G	A	1: 159,852,286	A277T	probably benign	Het
Trpm3	G	A	19: 22,914,417		probably benign	Het
Ttc30a1	A	T	2: 75,980,352	N462K	probably damaging	Het
Unc13a	C	T	8: 71,661,833	G181D	probably benign	Het
Vmn1r11	T	A	6: 57,137,507	L52Q	possibly damaging	Het
Zfp27	T	C	7: 29,895,829	D237G	possibly damaging	Het
Zfp39	T	C	11: 58,902,844	T23A	possibly damaging	Het
Zfp459	T	G	13: 67,408,481	N161T	probably benign	Het

Other mutations in Tcaf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Tcaf3	APN	6	42593385	missense	probably benign	0.14
IGL00931:Tcaf3	APN	6	42597228	missense	probably benign	0.16
IGL01391:Tcaf3	APN	6	42593681	missense	probably damaging	1.00
IGL01804:Tcaf3	APN	6	42597129	missense	probably damaging	1.00
IGL02272:Tcaf3	APN	6	42596660	missense	probably damaging	0.98
IGL02934:Tcaf3	APN	6	42593898	missense	probably benign	0.00
IGL03258:Tcaf3	APN	6	42589839	missense	probably damaging	1.00
defused	UTSW	6	42596933	missense	probably benign	0.03
R0116:Tcaf3	UTSW	6	42591350	missense	probably benign	0.12
R0135:Tcaf3	UTSW	6	42589758	missense	probably benign
R0357:Tcaf3	UTSW	6	42589827	missense	probably damaging	0.98
R0526:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R0592:Tcaf3	UTSW	6	42596843	missense	probably benign	0.16
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1185:Tcaf3	UTSW	6	42591434	missense	probably damaging	1.00
R1902:Tcaf3	UTSW	6	42593552	missense	possibly damaging	0.83
R1912:Tcaf3	UTSW	6	42596688	missense	possibly damaging	0.59
R2020:Tcaf3	UTSW	6	42593724	missense	possibly damaging	0.66
R2238:Tcaf3	UTSW	6	42593328	missense	probably benign	0.00
R2259:Tcaf3	UTSW	6	42591430	missense	possibly damaging	0.53
R2436:Tcaf3	UTSW	6	42593729	missense	probably damaging	1.00
R3005:Tcaf3	UTSW	6	42594044	missense	probably damaging	1.00
R3402:Tcaf3	UTSW	6	42593853	missense	probably benign	0.08
R3753:Tcaf3	UTSW	6	42589804	missense	probably damaging	1.00
R3799:Tcaf3	UTSW	6	42597080	missense	probably damaging	1.00
R4515:Tcaf3	UTSW	6	42589996	missense	probably damaging	1.00
R4640:Tcaf3	UTSW	6	42587579	missense	probably damaging	0.96
R4688:Tcaf3	UTSW	6	42593366	splice site	probably null
R4904:Tcaf3	UTSW	6	42593997	nonsense	probably null
R5030:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5031:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5045:Tcaf3	UTSW	6	42593684	missense	possibly damaging	0.55
R5105:Tcaf3	UTSW	6	42591325	missense	probably damaging	1.00
R5139:Tcaf3	UTSW	6	42596933	missense	probably benign	0.03
R5187:Tcaf3	UTSW	6	42597020	missense	possibly damaging	0.51
R5196:Tcaf3	UTSW	6	42593715	missense	probably benign	0.00
R5213:Tcaf3	UTSW	6	42591467	missense	probably damaging	1.00
R5296:Tcaf3	UTSW	6	42587510	missense	possibly damaging	0.55
R5402:Tcaf3	UTSW	6	42591926	missense	probably benign	0.12
R5425:Tcaf3	UTSW	6	42596763	missense	probably damaging	1.00
R5431:Tcaf3	UTSW	6	42597185	missense	probably damaging	1.00
R5601:Tcaf3	UTSW	6	42587528	missense	possibly damaging	0.90
R5839:Tcaf3	UTSW	6	42593849	missense	possibly damaging	0.55
R5865:Tcaf3	UTSW	6	42596697	missense	probably benign	0.07
R6005:Tcaf3	UTSW	6	42589971	missense	probably benign	0.19
R6270:Tcaf3	UTSW	6	42593791	missense	probably benign	0.00
R6341:Tcaf3	UTSW	6	42597259	missense	possibly damaging	0.55
R6344:Tcaf3	UTSW	6	42597171	missense	possibly damaging	0.48
R6521:Tcaf3	UTSW	6	42593238	missense	probably damaging	0.99
R6589:Tcaf3	UTSW	6	42594061	missense	possibly damaging	0.55
R6981:Tcaf3	UTSW	6	42597125	missense	probably damaging	1.00
R7155:Tcaf3	UTSW	6	42593891	missense	probably benign
R7185:Tcaf3	UTSW	6	42593930	missense	probably benign	0.01
R7262:Tcaf3	UTSW	6	42593801	missense	probably damaging	0.97
R7340:Tcaf3	UTSW	6	42589914	missense	probably benign	0.08
R7421:Tcaf3	UTSW	6	42596842	missense	probably benign	0.02
R7690:Tcaf3	UTSW	6	42597135	missense	probably damaging	1.00
R7850:Tcaf3	UTSW	6	42594206	splice site	probably null
R7909:Tcaf3	UTSW	6	42591964	missense	possibly damaging	0.92
R9419:Tcaf3	UTSW	6	42596782	missense	probably benign	0.00
R9440:Tcaf3	UTSW	6	42596972	nonsense	probably null
R9469:Tcaf3	UTSW	6	42596894	missense	probably benign	0.00
R9668:Tcaf3	UTSW	6	42589702	missense	probably damaging	1.00
R9787:Tcaf3	UTSW	6	42597090	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGGTGGATGGAAAGTCAACTCTCAG -3'
(R):5'- GGGTAAGTAGGAAACCCAGTTTCAGTG -3'

Sequencing Primer
(F):5'- TGGAAAGTCAACTCTCAGAACATTC -3'
(R):5'- TGGGCCAAGCTAGGTAACTT -3'

Posted On

2014-05-23