Mutagenetix > Incidental Mutation

Incidental Mutation 'R1185:Dusp13b'

200872

Institutional Source

Beutler Lab

Gene Symbol

Dusp13b

Ensembl Gene

ENSMUSG00000021768

Gene Name

dual specificity phosphatase 13B

Synonyms

TS-DSP6, TMDP, Dusp13, LMW-DSP6, LOC382853

MMRRC Submission

039257-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1185 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21783463-21792947 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21785086 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 141 (F141S)

Ref Sequence

ENSEMBL: ENSMUSP00000139154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075040] [ENSMUST00000119866] [ENSMUST00000120956] [ENSMUST00000120984] [ENSMUST00000127851] [ENSMUST00000183698] [ENSMUST00000183893] [ENSMUST00000184703] [ENSMUST00000183943] [ENSMUST00000184571]

AlphaFold

Q9QYJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000075040

SMART Domains

Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
DSPc	37	181	7.66e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119866
AA Change: F209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112552
Gene: ENSMUSG00000021768
AA Change: F209S

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120956
AA Change: F156S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113305
Gene: ENSMUSG00000021768
AA Change: F156S

Domain	Start	End	E-Value	Type
DSPc	110	255	9.29e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120984
AA Change: F91S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113985
Gene: ENSMUSG00000021768
AA Change: F91S

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127851

SMART Domains

Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
SCOP:d1vhra_	20	133	9e-10	SMART
Blast:DSPc	37	129	5e-60	BLAST
PDB:2E0T\|A	39	129	1e-26	PDB
low complexity region	162	173	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183698
AA Change: F114S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139058
Gene: ENSMUSG00000021768
AA Change: F114S

Domain	Start	End	E-Value	Type
DSPc	68	213	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183893

SMART Domains

Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000184703
AA Change: F91S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138972
Gene: ENSMUSG00000021768
AA Change: F91S

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000183943
AA Change: F141S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768
AA Change: F141S

Domain	Start	End	E-Value	Type
internal_repeat_1	19	71	6.78e-8	PROSPERO
DSPc	95	240	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184571

Meta Mutation Damage Score

0.2014

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ac165356.1	C	T	7: 105,682,686 (GRCm39)	A190T	probably benign	Het
Aimp2	A	G	5: 143,841,509 (GRCm39)	S110P	possibly damaging	Het
Akap9	A	G	5: 3,998,783 (GRCm39)	T51A	probably benign	Het
Arhgef25	A	G	10: 127,019,650 (GRCm39)	F430L	possibly damaging	Het
Brap	T	C	5: 121,813,342 (GRCm39)	V235A	probably damaging	Het
Cd69	C	T	6: 129,247,148 (GRCm39)	G23D	probably damaging	Het
Cecr2	C	T	6: 120,735,166 (GRCm39)	R24*	probably null	Het
Celsr2	T	C	3: 108,307,025 (GRCm39)	D1974G	possibly damaging	Het
Cps1	A	G	1: 67,234,358 (GRCm39)	K915R	probably benign	Het
Csmd1	T	C	8: 16,408,362 (GRCm39)	D401G	probably damaging	Het
Eif1ad19	A	G	12: 87,740,478 (GRCm39)	V27A	probably benign	Het
Fam162b	A	G	10: 51,466,439 (GRCm39)	W27R	probably benign	Het
Focad	A	G	4: 88,096,424 (GRCm39)	T269A	probably benign	Het
Ghr	T	A	15: 3,357,544 (GRCm39)	R241S	possibly damaging	Het
Hirip3	AAGAG	AAG	7: 126,462,832 (GRCm39)		probably null	Het
Ift70a1	A	T	2: 75,810,696 (GRCm39)	N462K	probably damaging	Het
Itgb2l	A	G	16: 96,230,240 (GRCm39)	Y357H	possibly damaging	Het
Jrkl	T	C	9: 13,244,938 (GRCm39)	D241G	possibly damaging	Het
Lmod1	A	G	1: 135,291,967 (GRCm39)	D274G	probably benign	Het
Lrrn2	A	G	1: 132,866,959 (GRCm39)	S675G	probably benign	Het
Ltbp4	G	C	7: 27,009,960 (GRCm39)	P1200R	probably damaging	Het
Mdn1	T	C	4: 32,735,576 (GRCm39)	L3414P	possibly damaging	Het
Muc19	A	G	15: 91,762,743 (GRCm39)		noncoding transcript	Het
Myo16	T	A	8: 10,683,624 (GRCm39)	S1856T	probably damaging	Het
Neb	A	G	2: 52,186,310 (GRCm39)	Y921H	probably damaging	Het
Or2n1c	T	A	17: 38,520,074 (GRCm39)	*313R	probably null	Het
Pgap3	T	C	11: 98,281,960 (GRCm39)	D117G	probably damaging	Het
Ppp1r9b	T	C	11: 94,892,812 (GRCm39)	F671L	possibly damaging	Het
Purg	T	G	8: 33,876,897 (GRCm39)	Y178*	probably null	Het
Rsph10b	G	A	5: 143,903,280 (GRCm39)		probably benign	Het
Sorbs1	T	A	19: 40,371,050 (GRCm39)	D79V	probably damaging	Het
Tcaf3	T	C	6: 42,568,368 (GRCm39)	T663A	probably damaging	Het
Timd4	C	A	11: 46,708,475 (GRCm39)	T167K	probably damaging	Het
Tjp2	A	G	19: 24,108,527 (GRCm39)	L195P	possibly damaging	Het
Tnr	G	A	1: 159,679,856 (GRCm39)	A277T	probably benign	Het
Trpm3	G	A	19: 22,891,781 (GRCm39)		probably benign	Het
Unc13a	C	T	8: 72,114,477 (GRCm39)	G181D	probably benign	Het
Vmn1r11	T	A	6: 57,114,492 (GRCm39)	L52Q	possibly damaging	Het
Zfp27	T	C	7: 29,595,254 (GRCm39)	D237G	possibly damaging	Het
Zfp39	T	C	11: 58,793,670 (GRCm39)	T23A	possibly damaging	Het
Zfp459	T	G	13: 67,556,600 (GRCm39)	N161T	probably benign	Het

Other mutations in Dusp13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01803:Dusp13b	APN	14	21,783,907 (GRCm39)	missense	probably damaging	1.00
IGL02963:Dusp13b	APN	14	21,783,875 (GRCm39)	missense	possibly damaging	0.86
R0827:Dusp13b	UTSW	14	21,792,839 (GRCm39)	missense	probably benign
R1185:Dusp13b	UTSW	14	21,785,086 (GRCm39)	missense	probably damaging	1.00
R1185:Dusp13b	UTSW	14	21,785,086 (GRCm39)	missense	probably damaging	1.00
R1882:Dusp13b	UTSW	14	21,785,043 (GRCm39)	missense	probably benign	0.04
R2915:Dusp13b	UTSW	14	21,790,205 (GRCm39)	missense	probably damaging	1.00
R3954:Dusp13b	UTSW	14	21,790,175 (GRCm39)	missense	probably damaging	1.00
R4623:Dusp13b	UTSW	14	21,793,546 (GRCm39)	unclassified	probably benign
R4837:Dusp13b	UTSW	14	21,793,593 (GRCm39)	utr 3 prime	probably benign
R6713:Dusp13b	UTSW	14	21,798,541 (GRCm39)	missense	probably damaging	1.00
R7294:Dusp13b	UTSW	14	21,783,782 (GRCm39)	missense	possibly damaging	0.47
R7782:Dusp13b	UTSW	14	21,791,404 (GRCm39)	missense	possibly damaging	0.86
R8088:Dusp13b	UTSW	14	21,791,305 (GRCm39)	missense	probably benign	0.33
R8176:Dusp13b	UTSW	14	21,797,549 (GRCm39)	missense	possibly damaging	0.81
R8227:Dusp13b	UTSW	14	21,792,869 (GRCm39)	missense	probably benign
R8520:Dusp13b	UTSW	14	21,793,538 (GRCm39)	nonsense	probably null
R8724:Dusp13b	UTSW	14	21,796,475 (GRCm39)	missense	probably benign	0.04
R8973:Dusp13b	UTSW	14	21,784,974 (GRCm39)	missense	probably benign	0.01
R9031:Dusp13b	UTSW	14	21,790,233 (GRCm39)	missense	probably benign	0.00
R9142:Dusp13b	UTSW	14	21,792,756 (GRCm39)	missense	probably benign	0.30
R9186:Dusp13b	UTSW	14	21,798,563 (GRCm39)	missense	probably damaging	0.97
R9258:Dusp13b	UTSW	14	21,791,155 (GRCm39)	missense	probably benign	0.44
R9630:Dusp13b	UTSW	14	21,784,974 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGGAGAAATAGTTCCTCATCCCGC -3'
(R):5'- CGCTTTTATCACCAGGGCAGTTCAC -3'

Sequencing Primer
(F):5'- CCTCATCCCGCCCTGAC -3'
(R):5'- ACCAGGGCAGTTCACTGTTTC -3'

Posted On

2014-05-23