Mutagenetix > Incidental Mutations

Incidental Mutation 'R1185:Itgb2l'

200875

Institutional Source

Beutler Lab

Gene Symbol

Itgb2l

Ensembl Gene

ENSMUSG00000000157

Gene Name

integrin beta 2-like

Synonyms

pactolus, 5033406G21Rik

MMRRC Submission

039257-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R1185 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96422288-96443619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96429040 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 357 (Y357H)

Ref Sequence

ENSEMBL: ENSMUSP00000114497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113795] [ENSMUST00000131567]

PDB Structure

PACTOLUS I-DOMAIN: FUNCTIONAL SWITCHING OF THE ROSSMANN FOLD [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000161
AA Change: Y357H

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: Y357H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	24	63	3.95e1	SMART
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART
EGF_like	553	585	4.64e1	SMART
Integrin_B_tail	594	669	1.22e-9	SMART
transmembrane domain	672	694	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113773
AA Change: Y357H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: Y357H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	24	63	3.95e1	SMART
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART
EGF_like	553	585	4.64e1	SMART
Integrin_B_tail	594	669	1.22e-9	SMART
transmembrane domain	672	694	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113795

SMART Domains

Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	31	125	4.74e-5	SMART
transmembrane domain	139	161	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131567
AA Change: Y357H

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157
AA Change: Y357H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131777

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

96% (45/47)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ac165356.1	C	T	7: 106,083,479	A190T	probably benign	Het
AC211878.1	A	G	12: 87,773,708	V27A	probably benign	Het
Aimp2	A	G	5: 143,904,691	S110P	possibly damaging	Het
Akap9	A	G	5: 3,948,783	T51A	probably benign	Het
Arhgef25	A	G	10: 127,183,781	F430L	possibly damaging	Het
Brap	T	C	5: 121,675,279	V235A	probably damaging	Het
Cd69	C	T	6: 129,270,185	G23D	probably damaging	Het
Cecr2	C	T	6: 120,758,205	R24*	probably null	Het
Celsr2	T	C	3: 108,399,709	D1974G	possibly damaging	Het
Cps1	A	G	1: 67,195,199	K915R	probably benign	Het
Csmd1	T	C	8: 16,358,348	D401G	probably damaging	Het
Dusp13	A	G	14: 21,735,018	F141S	probably damaging	Het
Fam162b	A	G	10: 51,590,343	W27R	probably benign	Het
Focad	A	G	4: 88,178,187	T269A	probably benign	Het
Ghr	T	A	15: 3,328,062	R241S	possibly damaging	Het
Hirip3	AAGAG	AAG	7: 126,863,660		probably null	Het
Jrkl	T	C	9: 13,244,933	D241G	possibly damaging	Het
Lmod1	A	G	1: 135,364,229	D274G	probably benign	Het
Lrrn2	A	G	1: 132,939,221	S675G	probably benign	Het
Ltbp4	G	C	7: 27,310,535	P1200R	probably damaging	Het
Mdn1	T	C	4: 32,735,576	L3414P	possibly damaging	Het
Muc19	A	G	15: 91,878,549		noncoding transcript	Het
Myo16	T	A	8: 10,633,624	S1856T	probably damaging	Het
Neb	A	G	2: 52,296,298	Y921H	probably damaging	Het
Olfr135	T	A	17: 38,209,183	*313R	probably null	Het
Pgap3	T	C	11: 98,391,134	D117G	probably damaging	Het
Ppp1r9b	T	C	11: 95,001,986	F671L	possibly damaging	Het
Purg	T	G	8: 33,386,869	Y178*	probably null	Het
Rsph10b	G	A	5: 143,966,462		probably benign	Het
Sorbs1	T	A	19: 40,382,606	D79V	probably damaging	Het
Tcaf3	T	C	6: 42,591,434	T663A	probably damaging	Het
Timd4	C	A	11: 46,817,648	T167K	probably damaging	Het
Tjp2	A	G	19: 24,131,163	L195P	possibly damaging	Het
Tnr	G	A	1: 159,852,286	A277T	probably benign	Het
Trpm3	G	A	19: 22,914,417		probably benign	Het
Ttc30a1	A	T	2: 75,980,352	N462K	probably damaging	Het
Unc13a	C	T	8: 71,661,833	G181D	probably benign	Het
Vmn1r11	T	A	6: 57,137,507	L52Q	possibly damaging	Het
Zfp27	T	C	7: 29,895,829	D237G	possibly damaging	Het
Zfp39	T	C	11: 58,902,844	T23A	possibly damaging	Het
Zfp459	T	G	13: 67,408,481	N161T	probably benign	Het

Other mutations in Itgb2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Itgb2l	APN	16	96426750	missense	probably damaging	0.98
IGL01482:Itgb2l	APN	16	96438748	missense	probably damaging	0.99
IGL01767:Itgb2l	APN	16	96430575	missense	probably benign	0.05
IGL02056:Itgb2l	APN	16	96427689	missense	probably damaging	0.97
IGL02072:Itgb2l	APN	16	96430608	missense	probably benign
IGL02858:Itgb2l	APN	16	96422650	missense	possibly damaging	0.96
R0011:Itgb2l	UTSW	16	96427661	splice site	probably benign
R0153:Itgb2l	UTSW	16	96437369	missense	possibly damaging	0.94
R0270:Itgb2l	UTSW	16	96422930	unclassified	probably benign
R0496:Itgb2l	UTSW	16	96434701	missense	possibly damaging	0.86
R0627:Itgb2l	UTSW	16	96422911	unclassified	probably benign
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1509:Itgb2l	UTSW	16	96426849	missense	probably benign	0.28
R1792:Itgb2l	UTSW	16	96425082	missense	probably damaging	1.00
R1912:Itgb2l	UTSW	16	96426935	missense	probably benign	0.17
R2210:Itgb2l	UTSW	16	96426221	missense	possibly damaging	0.82
R3160:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R3162:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R3836:Itgb2l	UTSW	16	96426167	missense	probably benign
R4131:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R4132:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R4254:Itgb2l	UTSW	16	96430577	missense	probably benign	0.00
R4854:Itgb2l	UTSW	16	96426117	nonsense	probably null
R4893:Itgb2l	UTSW	16	96427821	missense	probably benign	0.12
R4931:Itgb2l	UTSW	16	96437449	missense	probably damaging	1.00
R5039:Itgb2l	UTSW	16	96425005	missense	possibly damaging	0.69
R5055:Itgb2l	UTSW	16	96427803	missense	probably damaging	1.00
R5960:Itgb2l	UTSW	16	96426259	missense	probably benign	0.00
R6412:Itgb2l	UTSW	16	96427729	missense	probably benign	0.04
R6966:Itgb2l	UTSW	16	96430643	missense	probably benign	0.02
R7149:Itgb2l	UTSW	16	96433559	missense	probably damaging	1.00
R7278:Itgb2l	UTSW	16	96429043	missense	probably damaging	1.00
R7293:Itgb2l	UTSW	16	96426796	nonsense	probably null
R7482:Itgb2l	UTSW	16	96426833	missense	probably benign	0.01
R7570:Itgb2l	UTSW	16	96426239	missense	probably benign	0.00
R7743:Itgb2l	UTSW	16	96437408	missense	probably damaging	1.00
R7771:Itgb2l	UTSW	16	96426972	missense	probably damaging	1.00
R8446:Itgb2l	UTSW	16	96432657	missense	probably damaging	1.00
X0018:Itgb2l	UTSW	16	96435676	missense	probably benign	0.01
Z1177:Itgb2l	UTSW	16	96437356	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGCTGGGCTATTCCAGGAGAGG -3'
(R):5'- TGTCATCAACACAAACAGGAGGGAC -3'

Sequencing Primer
(F):5'- TAGAACCTGGGCTCTGCTAAG -3'
(R):5'- ACGTGAGAAGTATCACAGTACTTAG -3'

Posted On

2014-05-23