Incidental Mutation 'R1392:Tmem246'
ID200884
Institutional Source Beutler Lab
Gene Symbol Tmem246
Ensembl Gene ENSMUSG00000039611
Gene Nametransmembrane protein 246
Synonyms
MMRRC Submission 039454-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1392 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49584506-49597876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49586919 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 83 (L83P)
Ref Sequence ENSEMBL: ENSMUSP00000115100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042750] [ENSMUST00000150664] [ENSMUST00000151542]
Predicted Effect probably damaging
Transcript: ENSMUST00000042750
AA Change: L83P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040885
Gene: ENSMUSG00000039611
AA Change: L83P

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 262 280 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150664
AA Change: L83P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115100
Gene: ENSMUSG00000039611
AA Change: L83P

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151542
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930005H10Rik T C 3: 115,888,004 probably benign Het
Cenpj T C 14: 56,534,854 probably benign Het
Csf1 A G 3: 107,756,630 V74A probably benign Het
Dsg4 T A 18: 20,446,247 probably benign Het
Hnrnpm A T 17: 33,658,415 S325T possibly damaging Het
Hunk T C 16: 90,472,464 S299P probably damaging Het
Kcnk4 C T 19: 6,927,663 V207I possibly damaging Het
Mettl7b T C 10: 128,960,698 T81A possibly damaging Het
Myo15 A G 11: 60,477,974 H520R possibly damaging Het
Nlrp2 A G 7: 5,329,015 probably benign Het
Olfr310 A T 7: 86,268,855 F311L probably benign Het
Olfr351 A T 2: 36,860,175 Y58N probably damaging Het
Phc2 A G 4: 128,745,087 H607R possibly damaging Het
Rsad2 A G 12: 26,445,440 V352A probably benign Het
Rtn4rl2 A G 2: 84,880,512 L136P probably damaging Het
Smc1b T C 15: 85,107,070 probably benign Het
Spef2 C T 15: 9,647,263 V993I probably benign Het
Tiam2 A G 17: 3,414,197 H67R possibly damaging Het
Vmn2r65 A T 7: 84,947,416 S144T probably benign Het
Vmn2r77 A G 7: 86,801,622 T239A probably benign Het
Other mutations in Tmem246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Tmem246 APN 4 49586860 missense possibly damaging 0.92
IGL02210:Tmem246 APN 4 49586686 missense probably benign
IGL03239:Tmem246 APN 4 49586034 missense probably damaging 0.99
R0344:Tmem246 UTSW 4 49586566 missense probably benign
R1134:Tmem246 UTSW 4 49586832 missense probably benign
R1392:Tmem246 UTSW 4 49586919 missense probably damaging 1.00
R2247:Tmem246 UTSW 4 49586209 missense probably benign 0.05
R2288:Tmem246 UTSW 4 49586445 missense probably damaging 1.00
R4630:Tmem246 UTSW 4 49586254 missense probably benign 0.40
R5530:Tmem246 UTSW 4 49586226 missense probably benign 0.04
R5939:Tmem246 UTSW 4 49586412 missense probably damaging 0.98
R5955:Tmem246 UTSW 4 49586613 missense probably damaging 1.00
R7009:Tmem246 UTSW 4 49586325 missense probably benign
R7837:Tmem246 UTSW 4 49586262 missense probably damaging 0.96
Z1088:Tmem246 UTSW 4 49587135 missense probably damaging 0.97
Z1177:Tmem246 UTSW 4 49586872 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGCAGCGATGACTCCAGGCAATAC -3'
(R):5'- TGGTGACATTTGGCTTACTGGCCC -3'

Sequencing Primer
(F):5'- AGGGTCATCACCGTAATCGTC -3'
(R):5'- GCTTACTGGCCCCGCTG -3'
Posted On2014-05-23