Incidental Mutation 'R1392:Smc1b'
ID 200895
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Name structural maintenance of chromosomes 1B
Synonyms Smc1l2, SMC1beta
MMRRC Submission 039454-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.704) question?
Stock # R1392 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 84948890-85016158 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 84991271 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068]
AlphaFold Q920F6
Predicted Effect probably benign
Transcript: ENSMUST00000023068
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930005H10Rik T C 3: 115,681,653 (GRCm39) probably benign Het
Cenpj T C 14: 56,772,311 (GRCm39) probably benign Het
Csf1 A G 3: 107,663,946 (GRCm39) V74A probably benign Het
Dsg4 T A 18: 20,579,304 (GRCm39) probably benign Het
Hnrnpm A T 17: 33,877,389 (GRCm39) S325T possibly damaging Het
Hunk T C 16: 90,269,352 (GRCm39) S299P probably damaging Het
Kcnk4 C T 19: 6,905,031 (GRCm39) V207I possibly damaging Het
Myo15a A G 11: 60,368,800 (GRCm39) H520R possibly damaging Het
Nlrp2 A G 7: 5,332,014 (GRCm39) probably benign Het
Or14c46 A T 7: 85,918,063 (GRCm39) F311L probably benign Het
Or1n1 A T 2: 36,750,187 (GRCm39) Y58N probably damaging Het
Pgap4 A G 4: 49,586,919 (GRCm39) L83P probably damaging Het
Phc2 A G 4: 128,638,880 (GRCm39) H607R possibly damaging Het
Rsad2 A G 12: 26,495,439 (GRCm39) V352A probably benign Het
Rtn4rl2 A G 2: 84,710,856 (GRCm39) L136P probably damaging Het
Spef2 C T 15: 9,647,349 (GRCm39) V993I probably benign Het
Tiam2 A G 17: 3,464,472 (GRCm39) H67R possibly damaging Het
Tmt1b T C 10: 128,796,567 (GRCm39) T81A possibly damaging Het
Vmn2r65 A T 7: 84,596,624 (GRCm39) S144T probably benign Het
Vmn2r77 A G 7: 86,450,830 (GRCm39) T239A probably benign Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85,013,901 (GRCm39) missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85,016,099 (GRCm39) missense probably damaging 1.00
IGL01656:Smc1b APN 15 84,998,977 (GRCm39) missense probably damaging 0.99
IGL01807:Smc1b APN 15 84,980,946 (GRCm39) missense probably damaging 0.97
IGL02094:Smc1b APN 15 84,982,092 (GRCm39) splice site probably benign
IGL02121:Smc1b APN 15 84,982,186 (GRCm39) missense probably benign
IGL02631:Smc1b APN 15 84,991,204 (GRCm39) missense probably damaging 0.98
IGL02678:Smc1b APN 15 84,949,201 (GRCm39) nonsense probably null
IGL03197:Smc1b APN 15 84,955,064 (GRCm39) missense possibly damaging 0.85
IGL03214:Smc1b APN 15 84,982,147 (GRCm39) nonsense probably null
IGL03218:Smc1b APN 15 84,973,914 (GRCm39) missense probably benign 0.07
IGL03232:Smc1b APN 15 85,013,921 (GRCm39) missense possibly damaging 0.68
adamantine UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
unbreakable UTSW 15 84,980,859 (GRCm39) missense probably benign
E0370:Smc1b UTSW 15 85,011,782 (GRCm39) missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 84,953,852 (GRCm39) missense possibly damaging 0.91
R0092:Smc1b UTSW 15 84,951,925 (GRCm39) unclassified probably benign
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0207:Smc1b UTSW 15 85,007,960 (GRCm39) missense probably benign
R0390:Smc1b UTSW 15 84,950,478 (GRCm39) missense probably damaging 1.00
R0440:Smc1b UTSW 15 84,996,874 (GRCm39) splice site probably benign
R0685:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R1109:Smc1b UTSW 15 84,997,016 (GRCm39) missense probably damaging 0.98
R1509:Smc1b UTSW 15 84,970,335 (GRCm39) missense probably benign
R1804:Smc1b UTSW 15 85,011,991 (GRCm39) missense possibly damaging 0.90
R1879:Smc1b UTSW 15 84,976,268 (GRCm39) missense probably benign 0.01
R2086:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2143:Smc1b UTSW 15 85,008,003 (GRCm39) missense probably benign
R2158:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2174:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2471:Smc1b UTSW 15 84,976,218 (GRCm39) missense probably damaging 0.98
R3689:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R3690:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R4178:Smc1b UTSW 15 85,004,848 (GRCm39) missense possibly damaging 0.94
R4420:Smc1b UTSW 15 84,997,031 (GRCm39) missense probably damaging 1.00
R4905:Smc1b UTSW 15 84,950,428 (GRCm39) missense probably damaging 1.00
R4919:Smc1b UTSW 15 85,001,305 (GRCm39) intron probably benign
R5114:Smc1b UTSW 15 84,949,185 (GRCm39) missense probably damaging 1.00
R5314:Smc1b UTSW 15 84,955,066 (GRCm39) missense probably benign 0.00
R5476:Smc1b UTSW 15 84,970,352 (GRCm39) missense probably damaging 0.97
R5593:Smc1b UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
R5690:Smc1b UTSW 15 84,996,974 (GRCm39) missense probably damaging 1.00
R5719:Smc1b UTSW 15 84,980,859 (GRCm39) missense probably benign
R5817:Smc1b UTSW 15 84,951,984 (GRCm39) missense probably damaging 0.99
R5834:Smc1b UTSW 15 84,973,866 (GRCm39) missense probably damaging 1.00
R5930:Smc1b UTSW 15 84,970,322 (GRCm39) missense probably damaging 1.00
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85,005,896 (GRCm39) missense probably damaging 1.00
R6306:Smc1b UTSW 15 85,011,824 (GRCm39) missense probably benign 0.30
R6392:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6426:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6435:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6436:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6437:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6508:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6512:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6703:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6737:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6775:Smc1b UTSW 15 84,973,881 (GRCm39) missense probably damaging 0.96
R6889:Smc1b UTSW 15 84,951,960 (GRCm39) missense probably damaging 1.00
R6908:Smc1b UTSW 15 84,991,211 (GRCm39) missense probably damaging 1.00
R7124:Smc1b UTSW 15 84,955,798 (GRCm39) missense probably damaging 0.98
R7400:Smc1b UTSW 15 84,953,921 (GRCm39) missense probably damaging 1.00
R7417:Smc1b UTSW 15 84,981,743 (GRCm39) missense probably benign 0.05
R7610:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R7873:Smc1b UTSW 15 84,994,851 (GRCm39) critical splice donor site probably null
R7890:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8004:Smc1b UTSW 15 84,981,815 (GRCm39) missense probably damaging 0.98
R8698:Smc1b UTSW 15 84,997,047 (GRCm39) missense probably benign 0.16
R8826:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8835:Smc1b UTSW 15 85,013,949 (GRCm39) missense possibly damaging 0.83
R8925:Smc1b UTSW 15 84,991,273 (GRCm39) splice site probably null
R9059:Smc1b UTSW 15 85,004,875 (GRCm39) nonsense probably null
R9149:Smc1b UTSW 15 84,950,431 (GRCm39) missense probably benign 0.00
R9241:Smc1b UTSW 15 84,976,209 (GRCm39) missense probably benign 0.00
R9245:Smc1b UTSW 15 85,004,846 (GRCm39) missense probably benign 0.03
R9301:Smc1b UTSW 15 85,011,995 (GRCm39) missense probably damaging 0.98
R9384:Smc1b UTSW 15 84,950,455 (GRCm39) missense probably damaging 0.99
R9750:Smc1b UTSW 15 85,016,106 (GRCm39) missense probably damaging 1.00
Z1176:Smc1b UTSW 15 85,016,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- tGATGAGGATTTACCTTTAGCTCTTGGACT -3'
(R):5'- TGTGTGGTATGATGCCTGAAAGCATAA -3'

Sequencing Primer
(F):5'- ACTAGTTGGCTTCTTTTGTCTCTTAG -3'
(R):5'- TTAAAGCACTCACTTAGAGCACTG -3'
Posted On 2014-05-23