Incidental Mutation 'R1464:Ccdc148'
ID 200911
Institutional Source Beutler Lab
Gene Symbol Ccdc148
Ensembl Gene ENSMUSG00000036641
Gene Name coiled-coil domain containing 148
Synonyms
MMRRC Submission 039518-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1464 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 58711082-58991027 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 58796374 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 463 (R463*)
Ref Sequence ENSEMBL: ENSMUSP00000153944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077687] [ENSMUST00000112589] [ENSMUST00000226455]
AlphaFold Q6P5U8
Predicted Effect probably null
Transcript: ENSMUST00000077687
AA Change: R391*
SMART Domains Protein: ENSMUSP00000076871
Gene: ENSMUSG00000036641
AA Change: R391*

DomainStartEndE-ValueType
coiled coil region 173 195 N/A INTRINSIC
coiled coil region 289 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 401 438 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134708
Predicted Effect probably null
Transcript: ENSMUST00000226455
AA Change: R463*
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A G 12: 31,234,914 (GRCm39) noncoding transcript Het
Abca2 T G 2: 25,337,846 (GRCm39) probably benign Het
Adamts8 T A 9: 30,862,673 (GRCm39) W86R probably benign Het
Adh1 A G 3: 137,994,508 (GRCm39) probably null Het
Adipor2 A T 6: 119,338,804 (GRCm39) W150R probably damaging Het
Aff4 T A 11: 53,263,351 (GRCm39) S124T probably damaging Het
Ahnak G T 19: 8,982,260 (GRCm39) K1181N probably damaging Het
Ak2 C A 4: 128,896,152 (GRCm39) probably benign Het
Alkbh5 A G 11: 60,429,873 (GRCm39) I209V probably benign Het
Ankrd11 T C 8: 123,619,463 (GRCm39) E1442G probably damaging Het
Apba2 T A 7: 64,345,297 (GRCm39) D162E probably benign Het
Asic3 G A 5: 24,618,819 (GRCm39) G37E probably damaging Het
AU040320 A T 4: 126,685,824 (GRCm39) K133N possibly damaging Het
C1qtnf7 A G 5: 43,766,481 (GRCm39) S34G probably benign Het
Carf A G 1: 60,165,065 (GRCm39) probably benign Het
Ccdc185 A G 1: 182,576,263 (GRCm39) I142T probably benign Het
Cd274 T C 19: 29,359,992 (GRCm39) probably benign Het
Chrna10 G A 7: 101,763,454 (GRCm39) P114S probably damaging Het
Chst10 A G 1: 38,904,772 (GRCm39) I311T probably damaging Het
Cpne9 T C 6: 113,271,698 (GRCm39) Y353H probably damaging Het
Cubn G T 2: 13,330,099 (GRCm39) A2594E possibly damaging Het
Cyp3a13 T C 5: 137,903,827 (GRCm39) N277S possibly damaging Het
Dctn4 A G 18: 60,671,478 (GRCm39) T117A probably damaging Het
Ddah1 A T 3: 145,559,029 (GRCm39) K96* probably null Het
Ddx5 A C 11: 106,675,711 (GRCm39) D326E probably benign Het
Dlg2 T C 7: 91,617,406 (GRCm39) S323P probably damaging Het
Dnaaf1 C T 8: 120,306,049 (GRCm39) H109Y probably damaging Het
Dnah8 C A 17: 30,914,147 (GRCm39) R1098S possibly damaging Het
Dnajc13 T C 9: 104,091,366 (GRCm39) T642A probably benign Het
Dnajc18 A G 18: 35,813,900 (GRCm39) S290P possibly damaging Het
Dscam T A 16: 96,602,453 (GRCm39) H663L possibly damaging Het
Eefsec C T 6: 88,353,182 (GRCm39) probably benign Het
Emc1 A G 4: 139,098,248 (GRCm39) N740S probably damaging Het
Enpp2 C T 15: 54,727,208 (GRCm39) G541D probably damaging Het
Fam234b C T 6: 135,205,490 (GRCm39) T485I probably benign Het
Fbxl13 A T 5: 21,688,989 (GRCm39) I773K probably benign Het
Fmo4 A G 1: 162,621,924 (GRCm39) F429S possibly damaging Het
Fndc3b A G 3: 27,494,334 (GRCm39) probably benign Het
Frem1 T C 4: 82,930,116 (GRCm39) S277G probably damaging Het
Gaa A G 11: 119,163,810 (GRCm39) I221V probably benign Het
Gnptab A G 10: 88,281,616 (GRCm39) probably benign Het
Gphn T A 12: 78,659,738 (GRCm39) probably benign Het
Helz2 T C 2: 180,881,447 (GRCm39) E345G probably damaging Het
Ifna4 G T 4: 88,760,237 (GRCm39) R47I probably damaging Het
Igsf21 C A 4: 139,761,836 (GRCm39) A281S probably benign Het
Ikzf3 T A 11: 98,407,731 (GRCm39) I37L probably benign Het
Inpp5d A T 1: 87,625,827 (GRCm39) probably benign Het
Jag1 T C 2: 136,957,568 (GRCm39) E48G probably damaging Het
Jarid2 G T 13: 45,001,857 (GRCm39) V57F probably damaging Het
Kcnj4 A G 15: 79,369,605 (GRCm39) L125P probably damaging Het
Kif21b A G 1: 136,083,891 (GRCm39) K713E possibly damaging Het
Layn T A 9: 50,968,886 (GRCm39) S286C probably damaging Het
Lepr T A 4: 101,592,878 (GRCm39) D164E probably benign Het
Macroh2a1 A T 13: 56,230,949 (GRCm39) S310T probably damaging Het
Map3k1 T C 13: 111,892,405 (GRCm39) H950R possibly damaging Het
Map4k5 C A 12: 69,852,124 (GRCm39) V801L possibly damaging Het
Mapkbp1 T A 2: 119,851,742 (GRCm39) S895T probably benign Het
Mthfr T A 4: 148,138,029 (GRCm39) probably benign Het
Naca T A 10: 127,884,157 (GRCm39) M2157K probably damaging Het
Nav2 T C 7: 49,011,952 (GRCm39) I61T probably damaging Het
Nkx2-5 C A 17: 27,058,253 (GRCm39) A234S probably benign Het
Nol8 G A 13: 49,830,264 (GRCm39) S1116N probably benign Het
Nphp3 T C 9: 103,909,078 (GRCm39) probably benign Het
Nppa T C 4: 148,085,304 (GRCm39) S5P probably benign Het
Nup210 A G 6: 91,030,551 (GRCm39) V123A possibly damaging Het
Or13a21 G T 7: 139,999,286 (GRCm39) N133K probably benign Het
Osbpl11 A G 16: 33,049,455 (GRCm39) K604R probably damaging Het
Osbpl1a C T 18: 13,047,615 (GRCm39) S113N probably benign Het
P2rx4 C A 5: 122,852,602 (GRCm39) P92Q probably damaging Het
Pde9a A T 17: 31,692,136 (GRCm39) Q148L probably benign Het
Phf21b T A 15: 84,689,160 (GRCm39) H122L probably damaging Het
Pik3ca T A 3: 32,515,990 (GRCm39) F977I probably damaging Het
Pkd1l3 A G 8: 110,363,059 (GRCm39) probably benign Het
Potefam1 A G 2: 111,055,748 (GRCm39) probably null Het
Pp2d1 T G 17: 53,823,015 (GRCm39) K17T possibly damaging Het
Ppp4r2 A G 6: 100,843,527 (GRCm39) E415G probably damaging Het
Pramel19 T A 4: 101,798,503 (GRCm39) L158Q probably damaging Het
Prkg1 A G 19: 30,556,270 (GRCm39) S559P probably damaging Het
Prss45 A T 9: 110,670,019 (GRCm39) Y276F possibly damaging Het
Ptk7 G T 17: 46,883,517 (GRCm39) N849K probably damaging Het
Rnf121 A G 7: 101,680,782 (GRCm39) I125T possibly damaging Het
Rnf17 A G 14: 56,699,368 (GRCm39) N502S probably damaging Het
Sap25 T A 5: 137,640,622 (GRCm39) Y167* probably null Het
Sdk2 G A 11: 113,720,906 (GRCm39) T1341I possibly damaging Het
Sgcb A G 5: 73,792,896 (GRCm39) V302A probably benign Het
Skor1 T A 9: 63,047,393 (GRCm39) M865L possibly damaging Het
Slc25a45 T C 19: 5,929,928 (GRCm39) probably benign Het
Slc2a3 A G 6: 122,714,269 (GRCm39) probably benign Het
Slc35g1 C A 19: 38,391,665 (GRCm39) L316I probably benign Het
Slco1a8 C T 6: 141,938,243 (GRCm39) W225* probably null Het
Spint4 T A 2: 164,540,568 (GRCm39) L33H probably damaging Het
Sptlc3 A T 2: 139,389,154 (GRCm39) D178V probably benign Het
Stoml1 A G 9: 58,167,709 (GRCm39) probably benign Het
Tbc1d2 T A 4: 46,606,491 (GRCm39) Y818F possibly damaging Het
Tbc1d24 A T 17: 24,400,197 (GRCm39) probably null Het
Teddm2 C T 1: 153,726,277 (GRCm39) W146* probably null Het
Ttn T A 2: 76,589,338 (GRCm39) D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 (GRCm39) T102A probably damaging Het
Uxs1 G A 1: 43,804,076 (GRCm39) Q280* probably null Het
Vmn1r167 T C 7: 23,204,681 (GRCm39) T112A possibly damaging Het
Vmn1r195 A T 13: 22,463,348 (GRCm39) I273L probably benign Het
Vmn1r28 T A 6: 58,242,217 (GRCm39) M20K probably benign Het
Vmn1r53 G A 6: 90,200,914 (GRCm39) L137F probably benign Het
Vmn2r105 G A 17: 20,449,004 (GRCm39) probably benign Het
Vps13b C T 15: 35,709,630 (GRCm39) A1859V probably benign Het
Vwa5b2 A G 16: 20,415,019 (GRCm39) H347R probably benign Het
Wnk2 G A 13: 49,235,451 (GRCm39) P655S probably damaging Het
Zan T G 5: 137,418,191 (GRCm39) D2969A unknown Het
Zbtb24 A G 10: 41,331,075 (GRCm39) H334R probably damaging Het
Zfp108 A G 7: 23,959,973 (GRCm39) D188G probably benign Het
Zfp784 A T 7: 5,038,800 (GRCm39) C253S possibly damaging Het
Zfr T G 15: 12,146,458 (GRCm39) C336W probably damaging Het
Other mutations in Ccdc148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ccdc148 APN 2 58,719,811 (GRCm39) missense probably benign 0.00
IGL02056:Ccdc148 APN 2 58,894,081 (GRCm39) splice site probably benign
IGL02470:Ccdc148 APN 2 58,891,911 (GRCm39) missense probably damaging 0.96
PIT4585001:Ccdc148 UTSW 2 58,872,988 (GRCm39) missense probably benign 0.01
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0348:Ccdc148 UTSW 2 58,894,084 (GRCm39) splice site probably null
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1675:Ccdc148 UTSW 2 58,870,566 (GRCm39) missense probably damaging 0.96
R1677:Ccdc148 UTSW 2 58,892,176 (GRCm39) missense probably damaging 1.00
R1832:Ccdc148 UTSW 2 58,891,911 (GRCm39) missense probably damaging 0.96
R1918:Ccdc148 UTSW 2 58,872,911 (GRCm39) missense probably damaging 1.00
R2114:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R2115:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R4657:Ccdc148 UTSW 2 58,891,900 (GRCm39) missense probably benign 0.04
R4921:Ccdc148 UTSW 2 58,719,814 (GRCm39) missense probably damaging 1.00
R5022:Ccdc148 UTSW 2 58,717,644 (GRCm39) missense probably damaging 1.00
R5809:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6164:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R6952:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6987:Ccdc148 UTSW 2 58,872,926 (GRCm39) missense probably damaging 1.00
R7121:Ccdc148 UTSW 2 58,717,579 (GRCm39) missense probably damaging 1.00
R7452:Ccdc148 UTSW 2 58,717,596 (GRCm39) missense probably damaging 1.00
R7493:Ccdc148 UTSW 2 58,899,160 (GRCm39) missense probably damaging 1.00
R7574:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R7666:Ccdc148 UTSW 2 58,824,512 (GRCm39) missense probably damaging 0.99
R7763:Ccdc148 UTSW 2 58,713,648 (GRCm39) missense probably benign
R8045:Ccdc148 UTSW 2 58,892,083 (GRCm39) critical splice donor site probably null
R8865:Ccdc148 UTSW 2 58,719,832 (GRCm39) missense possibly damaging 0.86
R8932:Ccdc148 UTSW 2 58,894,054 (GRCm39) missense probably benign 0.40
R9597:Ccdc148 UTSW 2 58,893,397 (GRCm39) missense probably benign 0.08
X0062:Ccdc148 UTSW 2 58,893,460 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACCTCATGCACACAGTGGGCAAC -3'
(R):5'- GCTAAGCCAAGCACTTTCCAGAGAC -3'

Sequencing Primer
(F):5'- AGTTGCCATCAAATCCTCTGG -3'
(R):5'- cacacacacacacacacac -3'
Posted On 2014-05-23