Incidental Mutation 'R1464:Pkd1l3'
ID200963
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Namepolycystic kidney disease 1 like 3
Synonyms
MMRRC Submission 039518-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1464 (G1)
Quality Score156
Status Not validated
Chromosome8
Chromosomal Location109614517-109674386 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 109636427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
Predicted Effect probably benign
Transcript: ENSMUST00000057344
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109242
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213034
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,225,403 probably null Het
6030469F06Rik A G 12: 31,184,915 noncoding transcript Het
Abca2 T G 2: 25,447,834 probably benign Het
Adamts8 T A 9: 30,951,377 W86R probably benign Het
Adh1 A G 3: 138,288,747 probably null Het
Adipor2 A T 6: 119,361,843 W150R probably damaging Het
Aff4 T A 11: 53,372,524 S124T probably damaging Het
Ahnak G T 19: 9,004,896 K1181N probably damaging Het
Ak2 C A 4: 129,002,359 probably benign Het
Alkbh5 A G 11: 60,539,047 I209V probably benign Het
Ankrd11 T C 8: 122,892,724 E1442G probably damaging Het
Apba2 T A 7: 64,695,549 D162E probably benign Het
Asic3 G A 5: 24,413,821 G37E probably damaging Het
AU040320 A T 4: 126,792,031 K133N possibly damaging Het
C1qtnf7 A G 5: 43,609,139 S34G probably benign Het
Carf A G 1: 60,125,906 probably benign Het
Ccdc148 T A 2: 58,906,362 R463* probably null Het
Ccdc148 T C 2: 58,934,443 R329G probably damaging Het
Ccdc185 A G 1: 182,748,698 I142T probably benign Het
Cd274 T C 19: 29,382,592 probably benign Het
Chrna10 G A 7: 102,114,247 P114S probably damaging Het
Chst10 A G 1: 38,865,691 I311T probably damaging Het
Cpne9 T C 6: 113,294,737 Y353H probably damaging Het
Cubn G T 2: 13,325,288 A2594E possibly damaging Het
Cyp3a13 T C 5: 137,905,565 N277S possibly damaging Het
Dctn4 A G 18: 60,538,406 T117A probably damaging Het
Ddah1 A T 3: 145,853,274 K96* probably null Het
Ddx5 A C 11: 106,784,885 D326E probably benign Het
Dlg2 T C 7: 91,968,198 S323P probably damaging Het
Dnaaf1 C T 8: 119,579,310 H109Y probably damaging Het
Dnah8 C A 17: 30,695,173 R1098S possibly damaging Het
Dnajc13 T C 9: 104,214,167 T642A probably benign Het
Dnajc18 A G 18: 35,680,847 S290P possibly damaging Het
Dscam T A 16: 96,801,253 H663L possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Emc1 A G 4: 139,370,937 N740S probably damaging Het
Enpp2 C T 15: 54,863,812 G541D probably damaging Het
Fam234b C T 6: 135,228,492 T485I probably benign Het
Fbxl13 A T 5: 21,483,991 I773K probably benign Het
Fmo4 A G 1: 162,794,355 F429S possibly damaging Het
Fndc3b A G 3: 27,440,185 probably benign Het
Frem1 T C 4: 83,011,879 S277G probably damaging Het
Gaa A G 11: 119,272,984 I221V probably benign Het
Gm12794 T A 4: 101,941,306 L158Q probably damaging Het
Gm6614 C T 6: 141,992,517 W225* probably null Het
Gnptab A G 10: 88,445,754 probably benign Het
Gphn T A 12: 78,612,964 probably benign Het
H2afy A T 13: 56,083,136 S310T probably damaging Het
Helz2 T C 2: 181,239,654 E345G probably damaging Het
Ifna4 G T 4: 88,842,000 R47I probably damaging Het
Igsf21 C A 4: 140,034,525 A281S probably benign Het
Ikzf3 T A 11: 98,516,905 I37L probably benign Het
Inpp5d A T 1: 87,698,105 probably benign Het
Jag1 T C 2: 137,115,648 E48G probably damaging Het
Jarid2 G T 13: 44,848,381 V57F probably damaging Het
Kcnj4 A G 15: 79,485,404 L125P probably damaging Het
Kif21b A G 1: 136,156,153 K713E possibly damaging Het
Layn T A 9: 51,057,586 S286C probably damaging Het
Lepr T A 4: 101,735,681 D164E probably benign Het
Map3k1 T C 13: 111,755,871 H950R possibly damaging Het
Map4k5 C A 12: 69,805,350 V801L possibly damaging Het
Mapkbp1 T A 2: 120,021,261 S895T probably benign Het
Mthfr T A 4: 148,053,572 probably benign Het
Naca T A 10: 128,048,288 M2157K probably damaging Het
Nav2 T C 7: 49,362,204 I61T probably damaging Het
Nkx2-5 C A 17: 26,839,279 A234S probably benign Het
Nol8 G A 13: 49,676,788 S1116N probably benign Het
Nphp3 T C 9: 104,031,879 probably benign Het
Nppa T C 4: 148,000,847 S5P probably benign Het
Nup210 A G 6: 91,053,569 V123A possibly damaging Het
Olfr532 G T 7: 140,419,373 N133K probably benign Het
Osbpl11 A G 16: 33,229,085 K604R probably damaging Het
Osbpl1a C T 18: 12,914,558 S113N probably benign Het
P2rx4 C A 5: 122,714,539 P92Q probably damaging Het
Pde9a A T 17: 31,473,162 Q148L probably benign Het
Phf21b T A 15: 84,804,959 H122L probably damaging Het
Pik3ca T A 3: 32,461,841 F977I probably damaging Het
Pp2d1 T G 17: 53,515,987 K17T possibly damaging Het
Ppp4r2 A G 6: 100,866,566 E415G probably damaging Het
Prkg1 A G 19: 30,578,870 S559P probably damaging Het
Prss45 A T 9: 110,840,951 Y276F possibly damaging Het
Ptk7 G T 17: 46,572,591 N849K probably damaging Het
Rnf121 A G 7: 102,031,575 I125T possibly damaging Het
Rnf17 A G 14: 56,461,911 N502S probably damaging Het
Sap25 T A 5: 137,642,360 Y167* probably null Het
Sdk2 G A 11: 113,830,080 T1341I possibly damaging Het
Sgcb A G 5: 73,635,553 V302A probably benign Het
Skor1 T A 9: 63,140,111 M865L possibly damaging Het
Slc25a45 T C 19: 5,879,900 probably benign Het
Slc2a3 A G 6: 122,737,310 probably benign Het
Slc35g1 C A 19: 38,403,217 L316I probably benign Het
Spint4 T A 2: 164,698,648 L33H probably damaging Het
Sptlc3 A T 2: 139,547,234 D178V probably benign Het
Stoml1 A G 9: 58,260,426 probably benign Het
Tbc1d2 T A 4: 46,606,491 Y818F possibly damaging Het
Tbc1d24 A T 17: 24,181,223 probably null Het
Teddm2 C T 1: 153,850,531 W146* probably null Het
Ttn T A 2: 76,758,994 D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 T102A probably damaging Het
Uxs1 G A 1: 43,764,916 Q280* probably null Het
Vmn1r167 T C 7: 23,505,256 T112A possibly damaging Het
Vmn1r195 A T 13: 22,279,178 I273L probably benign Het
Vmn1r28 T A 6: 58,265,232 M20K probably benign Het
Vmn1r53 G A 6: 90,223,932 L137F probably benign Het
Vmn2r105 G A 17: 20,228,742 probably benign Het
Vps13b C T 15: 35,709,484 A1859V probably benign Het
Vwa5b2 A G 16: 20,596,269 H347R probably benign Het
Wnk2 G A 13: 49,081,975 P655S probably damaging Het
Zan T G 5: 137,419,929 D2969A unknown Het
Zbtb24 A G 10: 41,455,079 H334R probably damaging Het
Zfp108 A G 7: 24,260,548 D188G probably benign Het
Zfp784 A T 7: 5,035,801 C253S possibly damaging Het
Zfr T G 15: 12,146,372 C336W probably damaging Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 109630237 missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 109638706 missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 109662241 missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 109623771 missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 109623521 missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 109667525 critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 109635302 missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 109648502 critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 109630166 missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 109631276 critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 109635301 missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 109660806 missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 109631378 missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 109635380 missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 109665585 missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 109669292 missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 109638664 missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 109631345 missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 109660802 missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 109638678 missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 109631076 missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02358:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02369:Pkd1l3 APN 8 109616345 missense unknown
IGL02481:Pkd1l3 APN 8 109614782 missense unknown
IGL02505:Pkd1l3 APN 8 109633216 missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 109647500 missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 109640890 nonsense probably null
IGL02715:Pkd1l3 APN 8 109626826 missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 109662104 splice site probably benign
IGL03059:Pkd1l3 APN 8 109648367 missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 109655533 nonsense probably null
IGL03206:Pkd1l3 APN 8 109623713 missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 109662106 splice site probably benign
PIT4453001:Pkd1l3 UTSW 8 109660801 missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 109664499 missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 109628633 splice site probably benign
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0255:Pkd1l3 UTSW 8 109638754 missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 109646499 splice site probably null
R0311:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0311:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0441:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0466:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0515:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 109621708 missense unknown
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 109640770 missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 109614813 missense unknown
R1574:Pkd1l3 UTSW 8 109614813 missense unknown
R1599:Pkd1l3 UTSW 8 109636384 missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 109623818 missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 109632605 missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 109648406 missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 109624199 missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 109647573 nonsense probably null
R2185:Pkd1l3 UTSW 8 109633195 missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 109620524 missense unknown
R2260:Pkd1l3 UTSW 8 109623636 missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 109628709 missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 109670721 makesense probably null
R2435:Pkd1l3 UTSW 8 109650702 missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 109623815 missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 109623990 missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 109667636 splice site probably benign
R3755:Pkd1l3 UTSW 8 109632539 missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 109636317 missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 109646879 missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 109624119 missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 109632713 intron probably null
R4893:Pkd1l3 UTSW 8 109638394 missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 109640843 missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 109665636 missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 109623155 missense unknown
R5207:Pkd1l3 UTSW 8 109633191 missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 109640792 missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 109667052 missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 109655520 missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 109630210 missense probably benign
R5623:Pkd1l3 UTSW 8 109623719 missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 109626836 missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 109623179 missense unknown
R6330:Pkd1l3 UTSW 8 109646909 missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 109631384 missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 109623963 missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 109623212 missense unknown
R6480:Pkd1l3 UTSW 8 109638387 nonsense probably null
R6519:Pkd1l3 UTSW 8 109628772 missense probably benign
R6654:Pkd1l3 UTSW 8 109624283 missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 109614769 missense unknown
R6733:Pkd1l3 UTSW 8 109648494 splice site probably null
R6753:Pkd1l3 UTSW 8 109624449 missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 109626814 missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 109614614 missense unknown
R6975:Pkd1l3 UTSW 8 109660907 missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7018:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7083:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7139:Pkd1l3 UTSW 8 109636340 missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7235:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7238:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7252:Pkd1l3 UTSW 8 109660698 missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7309:Pkd1l3 UTSW 8 109648261 synonymous probably null
R7362:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7462:Pkd1l3 UTSW 8 109628777 missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 109638376 missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 109633315 missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7516:Pkd1l3 UTSW 8 109635229 missense probably damaging 1.00
R7537:Pkd1l3 UTSW 8 109623788 small deletion probably benign
R7553:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7559:Pkd1l3 UTSW 8 109624440 missense probably benign 0.03
X0026:Pkd1l3 UTSW 8 109614553 missense probably null
Z31818:Pkd1l3 UTSW 8 109669292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGTCTCTGTGACCACCTGAC -3'
(R):5'- TCCTGTGAAGATCCTACCATAGCACC -3'

Sequencing Primer
(F):5'- GACCTTCTTCAGCAGCGAC -3'
(R):5'- accaaaaccaaccaaccaaac -3'
Posted On2014-05-23