Incidental Mutation 'R1464:Gphn'
ID200984
Institutional Source Beutler Lab
Gene Symbol Gphn
Ensembl Gene ENSMUSG00000047454
Gene Namegephyrin
Synonyms5730552E08Rik, geph
MMRRC Submission 039518-MU
Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1464 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location78226379-78684772 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 78612964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]
Predicted Effect probably benign
Transcript: ENSMUST00000052472
SMART Domains Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 356 522 5.6e-53 PFAM
MoCF_biosynth 535 678 8.1e-38 SMART
Pfam:MoeA_C 691 766 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110388
SMART Domains Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 360 525 2.1e-35 PFAM
MoCF_biosynth 538 681 8.1e-38 SMART
Pfam:MoeA_C 694 769 8.1e-26 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,225,403 probably null Het
6030469F06Rik A G 12: 31,184,915 noncoding transcript Het
Abca2 T G 2: 25,447,834 probably benign Het
Adamts8 T A 9: 30,951,377 W86R probably benign Het
Adh1 A G 3: 138,288,747 probably null Het
Adipor2 A T 6: 119,361,843 W150R probably damaging Het
Aff4 T A 11: 53,372,524 S124T probably damaging Het
Ahnak G T 19: 9,004,896 K1181N probably damaging Het
Ak2 C A 4: 129,002,359 probably benign Het
Alkbh5 A G 11: 60,539,047 I209V probably benign Het
Ankrd11 T C 8: 122,892,724 E1442G probably damaging Het
Apba2 T A 7: 64,695,549 D162E probably benign Het
Asic3 G A 5: 24,413,821 G37E probably damaging Het
AU040320 A T 4: 126,792,031 K133N possibly damaging Het
C1qtnf7 A G 5: 43,609,139 S34G probably benign Het
Carf A G 1: 60,125,906 probably benign Het
Ccdc148 T A 2: 58,906,362 R463* probably null Het
Ccdc148 T C 2: 58,934,443 R329G probably damaging Het
Ccdc185 A G 1: 182,748,698 I142T probably benign Het
Cd274 T C 19: 29,382,592 probably benign Het
Chrna10 G A 7: 102,114,247 P114S probably damaging Het
Chst10 A G 1: 38,865,691 I311T probably damaging Het
Cpne9 T C 6: 113,294,737 Y353H probably damaging Het
Cubn G T 2: 13,325,288 A2594E possibly damaging Het
Cyp3a13 T C 5: 137,905,565 N277S possibly damaging Het
Dctn4 A G 18: 60,538,406 T117A probably damaging Het
Ddah1 A T 3: 145,853,274 K96* probably null Het
Ddx5 A C 11: 106,784,885 D326E probably benign Het
Dlg2 T C 7: 91,968,198 S323P probably damaging Het
Dnaaf1 C T 8: 119,579,310 H109Y probably damaging Het
Dnah8 C A 17: 30,695,173 R1098S possibly damaging Het
Dnajc13 T C 9: 104,214,167 T642A probably benign Het
Dnajc18 A G 18: 35,680,847 S290P possibly damaging Het
Dscam T A 16: 96,801,253 H663L possibly damaging Het
Eefsec C T 6: 88,376,200 probably benign Het
Emc1 A G 4: 139,370,937 N740S probably damaging Het
Enpp2 C T 15: 54,863,812 G541D probably damaging Het
Fam234b C T 6: 135,228,492 T485I probably benign Het
Fbxl13 A T 5: 21,483,991 I773K probably benign Het
Fmo4 A G 1: 162,794,355 F429S possibly damaging Het
Fndc3b A G 3: 27,440,185 probably benign Het
Frem1 T C 4: 83,011,879 S277G probably damaging Het
Gaa A G 11: 119,272,984 I221V probably benign Het
Gm12794 T A 4: 101,941,306 L158Q probably damaging Het
Gm6614 C T 6: 141,992,517 W225* probably null Het
Gnptab A G 10: 88,445,754 probably benign Het
H2afy A T 13: 56,083,136 S310T probably damaging Het
Helz2 T C 2: 181,239,654 E345G probably damaging Het
Ifna4 G T 4: 88,842,000 R47I probably damaging Het
Igsf21 C A 4: 140,034,525 A281S probably benign Het
Ikzf3 T A 11: 98,516,905 I37L probably benign Het
Inpp5d A T 1: 87,698,105 probably benign Het
Jag1 T C 2: 137,115,648 E48G probably damaging Het
Jarid2 G T 13: 44,848,381 V57F probably damaging Het
Kcnj4 A G 15: 79,485,404 L125P probably damaging Het
Kif21b A G 1: 136,156,153 K713E possibly damaging Het
Layn T A 9: 51,057,586 S286C probably damaging Het
Lepr T A 4: 101,735,681 D164E probably benign Het
Map3k1 T C 13: 111,755,871 H950R possibly damaging Het
Map4k5 C A 12: 69,805,350 V801L possibly damaging Het
Mapkbp1 T A 2: 120,021,261 S895T probably benign Het
Mthfr T A 4: 148,053,572 probably benign Het
Naca T A 10: 128,048,288 M2157K probably damaging Het
Nav2 T C 7: 49,362,204 I61T probably damaging Het
Nkx2-5 C A 17: 26,839,279 A234S probably benign Het
Nol8 G A 13: 49,676,788 S1116N probably benign Het
Nphp3 T C 9: 104,031,879 probably benign Het
Nppa T C 4: 148,000,847 S5P probably benign Het
Nup210 A G 6: 91,053,569 V123A possibly damaging Het
Olfr532 G T 7: 140,419,373 N133K probably benign Het
Osbpl11 A G 16: 33,229,085 K604R probably damaging Het
Osbpl1a C T 18: 12,914,558 S113N probably benign Het
P2rx4 C A 5: 122,714,539 P92Q probably damaging Het
Pde9a A T 17: 31,473,162 Q148L probably benign Het
Phf21b T A 15: 84,804,959 H122L probably damaging Het
Pik3ca T A 3: 32,461,841 F977I probably damaging Het
Pkd1l3 A G 8: 109,636,427 probably benign Het
Pp2d1 T G 17: 53,515,987 K17T possibly damaging Het
Ppp4r2 A G 6: 100,866,566 E415G probably damaging Het
Prkg1 A G 19: 30,578,870 S559P probably damaging Het
Prss45 A T 9: 110,840,951 Y276F possibly damaging Het
Ptk7 G T 17: 46,572,591 N849K probably damaging Het
Rnf121 A G 7: 102,031,575 I125T possibly damaging Het
Rnf17 A G 14: 56,461,911 N502S probably damaging Het
Sap25 T A 5: 137,642,360 Y167* probably null Het
Sdk2 G A 11: 113,830,080 T1341I possibly damaging Het
Sgcb A G 5: 73,635,553 V302A probably benign Het
Skor1 T A 9: 63,140,111 M865L possibly damaging Het
Slc25a45 T C 19: 5,879,900 probably benign Het
Slc2a3 A G 6: 122,737,310 probably benign Het
Slc35g1 C A 19: 38,403,217 L316I probably benign Het
Spint4 T A 2: 164,698,648 L33H probably damaging Het
Sptlc3 A T 2: 139,547,234 D178V probably benign Het
Stoml1 A G 9: 58,260,426 probably benign Het
Tbc1d2 T A 4: 46,606,491 Y818F possibly damaging Het
Tbc1d24 A T 17: 24,181,223 probably null Het
Teddm2 C T 1: 153,850,531 W146* probably null Het
Ttn T A 2: 76,758,994 D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 T102A probably damaging Het
Uxs1 G A 1: 43,764,916 Q280* probably null Het
Vmn1r167 T C 7: 23,505,256 T112A possibly damaging Het
Vmn1r195 A T 13: 22,279,178 I273L probably benign Het
Vmn1r28 T A 6: 58,265,232 M20K probably benign Het
Vmn1r53 G A 6: 90,223,932 L137F probably benign Het
Vmn2r105 G A 17: 20,228,742 probably benign Het
Vps13b C T 15: 35,709,484 A1859V probably benign Het
Vwa5b2 A G 16: 20,596,269 H347R probably benign Het
Wnk2 G A 13: 49,081,975 P655S probably damaging Het
Zan T G 5: 137,419,929 D2969A unknown Het
Zbtb24 A G 10: 41,455,079 H334R probably damaging Het
Zfp108 A G 7: 24,260,548 D188G probably benign Het
Zfp784 A T 7: 5,035,801 C253S possibly damaging Het
Zfr T G 15: 12,146,372 C336W probably damaging Het
Other mutations in Gphn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gphn APN 12 78504632 missense probably damaging 1.00
IGL00701:Gphn APN 12 78626167 missense possibly damaging 0.93
IGL00844:Gphn APN 12 78664568 splice site probably benign
IGL01517:Gphn APN 12 78376374 missense probably damaging 1.00
IGL02499:Gphn APN 12 78492300 missense probably benign 0.17
IGL02827:Gphn APN 12 78609220 missense probably damaging 1.00
IGL03136:Gphn APN 12 78481333 missense possibly damaging 0.69
IGL03348:Gphn APN 12 78627119 missense probably damaging 0.99
IGL03382:Gphn APN 12 78481313 missense probably damaging 1.00
grizzlies UTSW 12 78654880 missense probably benign 0.28
3-1:Gphn UTSW 12 78613001 missense probably benign 0.06
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0212:Gphn UTSW 12 78637552 missense probably damaging 0.99
R0389:Gphn UTSW 12 78590659 missense probably damaging 1.00
R0535:Gphn UTSW 12 78492050 missense possibly damaging 0.90
R1503:Gphn UTSW 12 78504629 missense possibly damaging 0.94
R1606:Gphn UTSW 12 78683883 missense probably damaging 1.00
R1896:Gphn UTSW 12 78412354 missense possibly damaging 0.74
R2248:Gphn UTSW 12 78454821 missense probably damaging 1.00
R3708:Gphn UTSW 12 78532693 missense probably benign
R3907:Gphn UTSW 12 78493942 splice site probably benign
R4537:Gphn UTSW 12 78494014 missense probably benign 0.03
R4667:Gphn UTSW 12 78454817 missense probably damaging 1.00
R4808:Gphn UTSW 12 78654880 missense probably benign 0.28
R4840:Gphn UTSW 12 78522955 critical splice donor site probably null
R4852:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4854:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4855:Gphn UTSW 12 78627210 missense probably damaging 1.00
R5083:Gphn UTSW 12 78623289 splice site probably null
R5224:Gphn UTSW 12 78590587 missense probably damaging 0.99
R5580:Gphn UTSW 12 78492044 missense probably damaging 1.00
R5626:Gphn UTSW 12 78683897 missense probably benign 0.11
R6270:Gphn UTSW 12 78522950 missense probably benign
R6563:Gphn UTSW 12 78680396 critical splice donor site probably null
R6943:Gphn UTSW 12 78492181 missense possibly damaging 0.88
R6958:Gphn UTSW 12 78680299 missense possibly damaging 0.86
R7170:Gphn UTSW 12 78683889 missense possibly damaging 0.67
R7295:Gphn UTSW 12 78492102 missense probably benign 0.02
R7514:Gphn UTSW 12 78626165 missense probably damaging 0.97
R7537:Gphn UTSW 12 78504680 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GATCAAGCCAGTCCTAGAACAGCG -3'
(R):5'- TTGTTACGTCTCCACAGACATGCC -3'

Sequencing Primer
(F):5'- GTCCTAGAACAGCGATTGTCTAC -3'
(R):5'- GACATGCCTCATAAGCATTTTCCAG -3'
Posted On2014-05-23