Incidental Mutation 'R1464:Dnah8'
ID 201003
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms P1-Loop, Dnahc8, Hst6.7b
MMRRC Submission 039518-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.477) question?
Stock # R1464 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 30845909-31094736 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 30914147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1098 (R1098S)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000170651
AA Change: R1098S

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: R1098S

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A G 12: 31,234,914 (GRCm39) noncoding transcript Het
Abca2 T G 2: 25,337,846 (GRCm39) probably benign Het
Adamts8 T A 9: 30,862,673 (GRCm39) W86R probably benign Het
Adh1 A G 3: 137,994,508 (GRCm39) probably null Het
Adipor2 A T 6: 119,338,804 (GRCm39) W150R probably damaging Het
Aff4 T A 11: 53,263,351 (GRCm39) S124T probably damaging Het
Ahnak G T 19: 8,982,260 (GRCm39) K1181N probably damaging Het
Ak2 C A 4: 128,896,152 (GRCm39) probably benign Het
Alkbh5 A G 11: 60,429,873 (GRCm39) I209V probably benign Het
Ankrd11 T C 8: 123,619,463 (GRCm39) E1442G probably damaging Het
Apba2 T A 7: 64,345,297 (GRCm39) D162E probably benign Het
Asic3 G A 5: 24,618,819 (GRCm39) G37E probably damaging Het
AU040320 A T 4: 126,685,824 (GRCm39) K133N possibly damaging Het
C1qtnf7 A G 5: 43,766,481 (GRCm39) S34G probably benign Het
Carf A G 1: 60,165,065 (GRCm39) probably benign Het
Ccdc148 T A 2: 58,796,374 (GRCm39) R463* probably null Het
Ccdc148 T C 2: 58,824,455 (GRCm39) R329G probably damaging Het
Ccdc185 A G 1: 182,576,263 (GRCm39) I142T probably benign Het
Cd274 T C 19: 29,359,992 (GRCm39) probably benign Het
Chrna10 G A 7: 101,763,454 (GRCm39) P114S probably damaging Het
Chst10 A G 1: 38,904,772 (GRCm39) I311T probably damaging Het
Cpne9 T C 6: 113,271,698 (GRCm39) Y353H probably damaging Het
Cubn G T 2: 13,330,099 (GRCm39) A2594E possibly damaging Het
Cyp3a13 T C 5: 137,903,827 (GRCm39) N277S possibly damaging Het
Dctn4 A G 18: 60,671,478 (GRCm39) T117A probably damaging Het
Ddah1 A T 3: 145,559,029 (GRCm39) K96* probably null Het
Ddx5 A C 11: 106,675,711 (GRCm39) D326E probably benign Het
Dlg2 T C 7: 91,617,406 (GRCm39) S323P probably damaging Het
Dnaaf1 C T 8: 120,306,049 (GRCm39) H109Y probably damaging Het
Dnajc13 T C 9: 104,091,366 (GRCm39) T642A probably benign Het
Dnajc18 A G 18: 35,813,900 (GRCm39) S290P possibly damaging Het
Dscam T A 16: 96,602,453 (GRCm39) H663L possibly damaging Het
Eefsec C T 6: 88,353,182 (GRCm39) probably benign Het
Emc1 A G 4: 139,098,248 (GRCm39) N740S probably damaging Het
Enpp2 C T 15: 54,727,208 (GRCm39) G541D probably damaging Het
Fam234b C T 6: 135,205,490 (GRCm39) T485I probably benign Het
Fbxl13 A T 5: 21,688,989 (GRCm39) I773K probably benign Het
Fmo4 A G 1: 162,621,924 (GRCm39) F429S possibly damaging Het
Fndc3b A G 3: 27,494,334 (GRCm39) probably benign Het
Frem1 T C 4: 82,930,116 (GRCm39) S277G probably damaging Het
Gaa A G 11: 119,163,810 (GRCm39) I221V probably benign Het
Gnptab A G 10: 88,281,616 (GRCm39) probably benign Het
Gphn T A 12: 78,659,738 (GRCm39) probably benign Het
Helz2 T C 2: 180,881,447 (GRCm39) E345G probably damaging Het
Ifna4 G T 4: 88,760,237 (GRCm39) R47I probably damaging Het
Igsf21 C A 4: 139,761,836 (GRCm39) A281S probably benign Het
Ikzf3 T A 11: 98,407,731 (GRCm39) I37L probably benign Het
Inpp5d A T 1: 87,625,827 (GRCm39) probably benign Het
Jag1 T C 2: 136,957,568 (GRCm39) E48G probably damaging Het
Jarid2 G T 13: 45,001,857 (GRCm39) V57F probably damaging Het
Kcnj4 A G 15: 79,369,605 (GRCm39) L125P probably damaging Het
Kif21b A G 1: 136,083,891 (GRCm39) K713E possibly damaging Het
Layn T A 9: 50,968,886 (GRCm39) S286C probably damaging Het
Lepr T A 4: 101,592,878 (GRCm39) D164E probably benign Het
Macroh2a1 A T 13: 56,230,949 (GRCm39) S310T probably damaging Het
Map3k1 T C 13: 111,892,405 (GRCm39) H950R possibly damaging Het
Map4k5 C A 12: 69,852,124 (GRCm39) V801L possibly damaging Het
Mapkbp1 T A 2: 119,851,742 (GRCm39) S895T probably benign Het
Mthfr T A 4: 148,138,029 (GRCm39) probably benign Het
Naca T A 10: 127,884,157 (GRCm39) M2157K probably damaging Het
Nav2 T C 7: 49,011,952 (GRCm39) I61T probably damaging Het
Nkx2-5 C A 17: 27,058,253 (GRCm39) A234S probably benign Het
Nol8 G A 13: 49,830,264 (GRCm39) S1116N probably benign Het
Nphp3 T C 9: 103,909,078 (GRCm39) probably benign Het
Nppa T C 4: 148,085,304 (GRCm39) S5P probably benign Het
Nup210 A G 6: 91,030,551 (GRCm39) V123A possibly damaging Het
Or13a21 G T 7: 139,999,286 (GRCm39) N133K probably benign Het
Osbpl11 A G 16: 33,049,455 (GRCm39) K604R probably damaging Het
Osbpl1a C T 18: 13,047,615 (GRCm39) S113N probably benign Het
P2rx4 C A 5: 122,852,602 (GRCm39) P92Q probably damaging Het
Pde9a A T 17: 31,692,136 (GRCm39) Q148L probably benign Het
Phf21b T A 15: 84,689,160 (GRCm39) H122L probably damaging Het
Pik3ca T A 3: 32,515,990 (GRCm39) F977I probably damaging Het
Pkd1l3 A G 8: 110,363,059 (GRCm39) probably benign Het
Potefam1 A G 2: 111,055,748 (GRCm39) probably null Het
Pp2d1 T G 17: 53,823,015 (GRCm39) K17T possibly damaging Het
Ppp4r2 A G 6: 100,843,527 (GRCm39) E415G probably damaging Het
Pramel19 T A 4: 101,798,503 (GRCm39) L158Q probably damaging Het
Prkg1 A G 19: 30,556,270 (GRCm39) S559P probably damaging Het
Prss45 A T 9: 110,670,019 (GRCm39) Y276F possibly damaging Het
Ptk7 G T 17: 46,883,517 (GRCm39) N849K probably damaging Het
Rnf121 A G 7: 101,680,782 (GRCm39) I125T possibly damaging Het
Rnf17 A G 14: 56,699,368 (GRCm39) N502S probably damaging Het
Sap25 T A 5: 137,640,622 (GRCm39) Y167* probably null Het
Sdk2 G A 11: 113,720,906 (GRCm39) T1341I possibly damaging Het
Sgcb A G 5: 73,792,896 (GRCm39) V302A probably benign Het
Skor1 T A 9: 63,047,393 (GRCm39) M865L possibly damaging Het
Slc25a45 T C 19: 5,929,928 (GRCm39) probably benign Het
Slc2a3 A G 6: 122,714,269 (GRCm39) probably benign Het
Slc35g1 C A 19: 38,391,665 (GRCm39) L316I probably benign Het
Slco1a8 C T 6: 141,938,243 (GRCm39) W225* probably null Het
Spint4 T A 2: 164,540,568 (GRCm39) L33H probably damaging Het
Sptlc3 A T 2: 139,389,154 (GRCm39) D178V probably benign Het
Stoml1 A G 9: 58,167,709 (GRCm39) probably benign Het
Tbc1d2 T A 4: 46,606,491 (GRCm39) Y818F possibly damaging Het
Tbc1d24 A T 17: 24,400,197 (GRCm39) probably null Het
Teddm2 C T 1: 153,726,277 (GRCm39) W146* probably null Het
Ttn T A 2: 76,589,338 (GRCm39) D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 (GRCm39) T102A probably damaging Het
Uxs1 G A 1: 43,804,076 (GRCm39) Q280* probably null Het
Vmn1r167 T C 7: 23,204,681 (GRCm39) T112A possibly damaging Het
Vmn1r195 A T 13: 22,463,348 (GRCm39) I273L probably benign Het
Vmn1r28 T A 6: 58,242,217 (GRCm39) M20K probably benign Het
Vmn1r53 G A 6: 90,200,914 (GRCm39) L137F probably benign Het
Vmn2r105 G A 17: 20,449,004 (GRCm39) probably benign Het
Vps13b C T 15: 35,709,630 (GRCm39) A1859V probably benign Het
Vwa5b2 A G 16: 20,415,019 (GRCm39) H347R probably benign Het
Wnk2 G A 13: 49,235,451 (GRCm39) P655S probably damaging Het
Zan T G 5: 137,418,191 (GRCm39) D2969A unknown Het
Zbtb24 A G 10: 41,331,075 (GRCm39) H334R probably damaging Het
Zfp108 A G 7: 23,959,973 (GRCm39) D188G probably benign Het
Zfp784 A T 7: 5,038,800 (GRCm39) C253S possibly damaging Het
Zfr T G 15: 12,146,458 (GRCm39) C336W probably damaging Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30,896,150 (GRCm39) missense probably benign 0.06
IGL00508:Dnah8 APN 17 31,074,904 (GRCm39) missense probably damaging 1.00
IGL00547:Dnah8 APN 17 31,034,677 (GRCm39) nonsense probably null
IGL00551:Dnah8 APN 17 30,882,452 (GRCm39) nonsense probably null
IGL00732:Dnah8 APN 17 30,875,615 (GRCm39) missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30,986,880 (GRCm39) nonsense probably null
IGL00840:Dnah8 APN 17 31,009,915 (GRCm39) missense probably damaging 1.00
IGL00845:Dnah8 APN 17 31,038,250 (GRCm39) critical splice donor site probably null
IGL00953:Dnah8 APN 17 30,925,431 (GRCm39) nonsense probably null
IGL00976:Dnah8 APN 17 31,070,684 (GRCm39) missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30,854,979 (GRCm39) missense probably benign 0.06
IGL01467:Dnah8 APN 17 30,998,890 (GRCm39) missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30,902,688 (GRCm39) splice site probably benign
IGL01515:Dnah8 APN 17 30,867,459 (GRCm39) missense probably benign
IGL01723:Dnah8 APN 17 30,927,445 (GRCm39) missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30,970,565 (GRCm39) critical splice donor site probably null
IGL01921:Dnah8 APN 17 30,955,115 (GRCm39) missense probably benign
IGL01958:Dnah8 APN 17 31,074,869 (GRCm39) splice site probably benign
IGL01968:Dnah8 APN 17 30,875,572 (GRCm39) nonsense probably null
IGL02093:Dnah8 APN 17 30,936,854 (GRCm39) missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30,867,391 (GRCm39) missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 31,013,737 (GRCm39) missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30,925,487 (GRCm39) critical splice donor site probably null
IGL02236:Dnah8 APN 17 30,868,747 (GRCm39) nonsense probably null
IGL02259:Dnah8 APN 17 30,978,588 (GRCm39) missense probably benign
IGL02263:Dnah8 APN 17 30,948,139 (GRCm39) missense probably benign 0.00
IGL02303:Dnah8 APN 17 30,932,021 (GRCm39) missense probably benign 0.03
IGL02341:Dnah8 APN 17 30,966,231 (GRCm39) missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02377:Dnah8 APN 17 31,013,770 (GRCm39) missense probably damaging 0.98
IGL02390:Dnah8 APN 17 31,049,819 (GRCm39) missense probably benign 0.01
IGL02392:Dnah8 APN 17 31,037,025 (GRCm39) splice site probably benign
IGL02414:Dnah8 APN 17 30,919,387 (GRCm39) missense probably benign
IGL02455:Dnah8 APN 17 30,891,308 (GRCm39) missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30,887,269 (GRCm39) missense probably benign
IGL02831:Dnah8 APN 17 30,931,250 (GRCm39) missense probably benign 0.23
IGL02863:Dnah8 APN 17 30,988,671 (GRCm39) missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30,940,084 (GRCm39) nonsense probably null
IGL02954:Dnah8 APN 17 30,923,809 (GRCm39) missense probably benign 0.30
IGL02964:Dnah8 APN 17 30,965,735 (GRCm39) missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30,937,980 (GRCm39) missense probably benign 0.01
IGL03081:Dnah8 APN 17 30,905,347 (GRCm39) splice site probably benign
IGL03086:Dnah8 APN 17 30,961,754 (GRCm39) missense probably damaging 1.00
IGL03087:Dnah8 APN 17 31,003,118 (GRCm39) missense probably benign
IGL03176:Dnah8 APN 17 30,913,011 (GRCm39) missense probably benign
IGL03191:Dnah8 APN 17 30,945,804 (GRCm39) missense probably damaging 0.99
IGL03210:Dnah8 APN 17 31,034,639 (GRCm39) missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30,892,894 (GRCm39) splice site probably null
IGL03255:Dnah8 APN 17 30,960,355 (GRCm39) missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30,891,323 (GRCm39) missense probably benign
IGL03348:Dnah8 APN 17 30,965,960 (GRCm39) missense probably damaging 0.99
Alternator UTSW 17 30,984,609 (GRCm39) missense probably benign
armature UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
Brush UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
Dynos UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
joule UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
solenoid UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30,854,437 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,451 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,439 (GRCm39) small deletion probably benign
I2288:Dnah8 UTSW 17 30,882,428 (GRCm39) missense probably benign
P0029:Dnah8 UTSW 17 30,984,694 (GRCm39) missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30,927,419 (GRCm39) missense probably benign 0.04
R0016:Dnah8 UTSW 17 30,882,290 (GRCm39) missense probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30,974,093 (GRCm39) missense probably damaging 1.00
R0090:Dnah8 UTSW 17 31,003,064 (GRCm39) missense probably benign 0.20
R0119:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0184:Dnah8 UTSW 17 30,902,657 (GRCm39) missense probably benign 0.04
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30,909,245 (GRCm39) missense probably benign
R0268:Dnah8 UTSW 17 30,988,681 (GRCm39) missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30,955,130 (GRCm39) missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 31,090,325 (GRCm39) missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
R0423:Dnah8 UTSW 17 30,920,955 (GRCm39) missense probably benign
R0470:Dnah8 UTSW 17 30,927,514 (GRCm39) splice site probably benign
R0477:Dnah8 UTSW 17 30,974,054 (GRCm39) missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R0499:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30,937,935 (GRCm39) missense probably benign 0.01
R0601:Dnah8 UTSW 17 30,927,332 (GRCm39) missense probably benign 0.06
R0646:Dnah8 UTSW 17 30,903,147 (GRCm39) missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30,955,129 (GRCm39) missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30,923,636 (GRCm39) missense probably benign
R0843:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R0940:Dnah8 UTSW 17 31,022,217 (GRCm39) missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30,892,894 (GRCm39) splice site probably null
R1102:Dnah8 UTSW 17 31,073,738 (GRCm39) splice site probably null
R1137:Dnah8 UTSW 17 31,074,910 (GRCm39) missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30,939,974 (GRCm39) missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30,956,269 (GRCm39) missense probably damaging 1.00
R1377:Dnah8 UTSW 17 31,059,596 (GRCm39) nonsense probably null
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1497:Dnah8 UTSW 17 30,971,049 (GRCm39) missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30,892,862 (GRCm39) missense probably benign
R1541:Dnah8 UTSW 17 30,966,221 (GRCm39) missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30,854,638 (GRCm39) missense probably benign 0.07
R1634:Dnah8 UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
R1670:Dnah8 UTSW 17 30,944,098 (GRCm39) missense probably damaging 1.00
R1710:Dnah8 UTSW 17 31,073,914 (GRCm39) missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30,988,625 (GRCm39) missense probably benign 0.28
R1761:Dnah8 UTSW 17 30,998,890 (GRCm39) missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30,941,911 (GRCm39) missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30,927,381 (GRCm39) missense probably benign 0.00
R1808:Dnah8 UTSW 17 30,903,160 (GRCm39) missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30,950,154 (GRCm39) missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30,854,479 (GRCm39) missense unknown
R1935:Dnah8 UTSW 17 30,945,870 (GRCm39) splice site probably benign
R1940:Dnah8 UTSW 17 30,950,181 (GRCm39) missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30,931,359 (GRCm39) missense probably benign 0.00
R2025:Dnah8 UTSW 17 30,950,133 (GRCm39) missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30,977,255 (GRCm39) missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30,854,632 (GRCm39) missense probably benign 0.01
R2148:Dnah8 UTSW 17 30,956,232 (GRCm39) missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30,872,367 (GRCm39) missense probably benign
R2180:Dnah8 UTSW 17 31,059,621 (GRCm39) missense probably benign 0.00
R2262:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2328:Dnah8 UTSW 17 31,013,718 (GRCm39) missense probably damaging 1.00
R2357:Dnah8 UTSW 17 31,093,909 (GRCm39) missense probably benign 0.00
R2357:Dnah8 UTSW 17 30,990,846 (GRCm39) missense probably benign
R2360:Dnah8 UTSW 17 30,896,178 (GRCm39) missense probably benign 0.22
R2496:Dnah8 UTSW 17 31,070,705 (GRCm39) missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30,960,339 (GRCm39) nonsense probably null
R2509:Dnah8 UTSW 17 30,994,019 (GRCm39) missense probably benign 0.02
R3114:Dnah8 UTSW 17 31,052,542 (GRCm39) missense probably benign 0.04
R3708:Dnah8 UTSW 17 30,958,631 (GRCm39) missense probably damaging 0.98
R3720:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3722:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30,958,622 (GRCm39) nonsense probably null
R3747:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3748:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3749:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3787:Dnah8 UTSW 17 30,974,015 (GRCm39) missense probably damaging 1.00
R3790:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30,889,621 (GRCm39) missense probably benign 0.00
R3857:Dnah8 UTSW 17 30,882,396 (GRCm39) missense probably damaging 0.96
R3898:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3899:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3938:Dnah8 UTSW 17 31,073,911 (GRCm39) missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30,913,039 (GRCm39) splice site probably benign
R4091:Dnah8 UTSW 17 30,988,813 (GRCm39) missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30,967,533 (GRCm39) missense probably benign
R4326:Dnah8 UTSW 17 30,971,066 (GRCm39) missense probably benign 0.04
R4346:Dnah8 UTSW 17 30,944,072 (GRCm39) missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30,971,120 (GRCm39) missense probably damaging 1.00
R4457:Dnah8 UTSW 17 31,032,125 (GRCm39) missense probably benign
R4475:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4565:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4566:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4568:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4573:Dnah8 UTSW 17 30,919,380 (GRCm39) missense probably benign 0.00
R4580:Dnah8 UTSW 17 30,881,026 (GRCm39) missense probably benign 0.00
R4585:Dnah8 UTSW 17 30,970,541 (GRCm39) missense probably benign 0.01
R4611:Dnah8 UTSW 17 30,903,211 (GRCm39) missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30,902,608 (GRCm39) missense probably benign 0.08
R4721:Dnah8 UTSW 17 30,944,140 (GRCm39) missense probably damaging 1.00
R4727:Dnah8 UTSW 17 31,070,721 (GRCm39) missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4732:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4733:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4798:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4814:Dnah8 UTSW 17 30,986,898 (GRCm39) missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4894:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4900:Dnah8 UTSW 17 30,965,949 (GRCm39) missense probably damaging 1.00
R4901:Dnah8 UTSW 17 31,059,688 (GRCm39) critical splice donor site probably null
R4913:Dnah8 UTSW 17 31,038,113 (GRCm39) missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4932:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4933:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4942:Dnah8 UTSW 17 30,948,116 (GRCm39) missense probably benign
R4969:Dnah8 UTSW 17 30,941,988 (GRCm39) missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4977:Dnah8 UTSW 17 30,882,275 (GRCm39) missense probably benign 0.00
R5001:Dnah8 UTSW 17 31,006,159 (GRCm39) missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5013:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5014:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5024:Dnah8 UTSW 17 30,955,070 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5075:Dnah8 UTSW 17 31,019,505 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,958,731 (GRCm39) critical splice donor site probably null
R5112:Dnah8 UTSW 17 30,950,012 (GRCm39) missense probably benign 0.02
R5121:Dnah8 UTSW 17 31,029,327 (GRCm39) missense probably benign 0.14
R5138:Dnah8 UTSW 17 30,984,571 (GRCm39) missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30,931,269 (GRCm39) missense probably benign 0.06
R5191:Dnah8 UTSW 17 30,965,739 (GRCm39) missense probably damaging 1.00
R5238:Dnah8 UTSW 17 31,009,891 (GRCm39) missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R5358:Dnah8 UTSW 17 30,965,928 (GRCm39) missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5404:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5482:Dnah8 UTSW 17 31,019,521 (GRCm39) missense probably damaging 0.96
R5489:Dnah8 UTSW 17 31,009,930 (GRCm39) missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30,971,890 (GRCm39) missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30,925,360 (GRCm39) missense probably benign 0.00
R5640:Dnah8 UTSW 17 31,022,082 (GRCm39) missense probably damaging 1.00
R5649:Dnah8 UTSW 17 31,019,561 (GRCm39) missense probably benign 0.13
R5662:Dnah8 UTSW 17 30,956,307 (GRCm39) missense probably damaging 1.00
R5673:Dnah8 UTSW 17 31,022,235 (GRCm39) missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5699:Dnah8 UTSW 17 31,029,298 (GRCm39) missense probably benign 0.22
R5737:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5738:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5739:Dnah8 UTSW 17 30,937,981 (GRCm39) missense probably benign 0.00
R5766:Dnah8 UTSW 17 30,909,235 (GRCm39) missense probably benign 0.01
R5790:Dnah8 UTSW 17 31,093,978 (GRCm39) missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30,947,165 (GRCm39) missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 31,013,737 (GRCm39) missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5886:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5887:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30,875,659 (GRCm39) missense probably benign 0.32
R5979:Dnah8 UTSW 17 31,034,638 (GRCm39) nonsense probably null
R5986:Dnah8 UTSW 17 31,070,604 (GRCm39) missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30,882,279 (GRCm39) missense probably benign 0.32
R6042:Dnah8 UTSW 17 30,966,239 (GRCm39) missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6181:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6237:Dnah8 UTSW 17 30,966,828 (GRCm39) nonsense probably null
R6239:Dnah8 UTSW 17 31,029,333 (GRCm39) missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6365:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6416:Dnah8 UTSW 17 30,984,609 (GRCm39) missense probably benign
R6443:Dnah8 UTSW 17 30,990,859 (GRCm39) missense probably benign 0.10
R6478:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6479:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6480:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6481:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6533:Dnah8 UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6608:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6610:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6675:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6723:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6724:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6754:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6755:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6759:Dnah8 UTSW 17 30,882,266 (GRCm39) splice site probably null
R6765:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6766:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6778:Dnah8 UTSW 17 30,854,640 (GRCm39) missense probably benign 0.00
R6781:Dnah8 UTSW 17 30,984,698 (GRCm39) frame shift probably null
R6788:Dnah8 UTSW 17 30,867,439 (GRCm39) missense probably benign 0.14
R6814:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30,960,147 (GRCm39) missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30,929,525 (GRCm39) missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30,965,933 (GRCm39) missense probably damaging 1.00
R6944:Dnah8 UTSW 17 31,013,633 (GRCm39) missense probably benign 0.09
R6982:Dnah8 UTSW 17 30,986,899 (GRCm39) missense probably benign 0.03
R6984:Dnah8 UTSW 17 30,958,712 (GRCm39) missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30,881,065 (GRCm39) missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30,862,249 (GRCm39) missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30,923,698 (GRCm39) missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
R7112:Dnah8 UTSW 17 31,090,366 (GRCm39) missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30,988,618 (GRCm39) missense possibly damaging 0.90
R7146:Dnah8 UTSW 17 30,863,591 (GRCm39) missense probably benign 0.01
R7309:Dnah8 UTSW 17 31,093,988 (GRCm39) missense probably damaging 1.00
R7324:Dnah8 UTSW 17 31,003,099 (GRCm39) missense probably benign 0.01
R7373:Dnah8 UTSW 17 30,986,939 (GRCm39) critical splice donor site probably null
R7423:Dnah8 UTSW 17 30,923,743 (GRCm39) missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30,925,363 (GRCm39) missense probably damaging 0.98
R7450:Dnah8 UTSW 17 31,006,165 (GRCm39) missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30,994,077 (GRCm39) missense probably damaging 0.98
R7604:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R7635:Dnah8 UTSW 17 31,004,081 (GRCm39) missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30,868,651 (GRCm39) missense probably benign 0.00
R7685:Dnah8 UTSW 17 30,876,947 (GRCm39) missense probably damaging 1.00
R7793:Dnah8 UTSW 17 31,074,918 (GRCm39) missense probably benign 0.20
R7827:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R7866:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30,882,348 (GRCm39) missense probably benign
R7891:Dnah8 UTSW 17 30,931,263 (GRCm39) missense probably benign 0.09
R7977:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30,960,311 (GRCm39) nonsense probably null
R8076:Dnah8 UTSW 17 31,003,127 (GRCm39) missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30,892,797 (GRCm39) missense probably damaging 1.00
R8199:Dnah8 UTSW 17 31,090,393 (GRCm39) missense probably benign 0.06
R8253:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8270:Dnah8 UTSW 17 31,059,687 (GRCm39) missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30,984,701 (GRCm39) missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30,988,805 (GRCm39) missense probably benign 0.12
R8348:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8348:Dnah8 UTSW 17 30,955,121 (GRCm39) missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30,862,234 (GRCm39) missense probably benign 0.17
R8355:Dnah8 UTSW 17 30,914,152 (GRCm39) missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8448:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8459:Dnah8 UTSW 17 30,944,221 (GRCm39) critical splice donor site probably null
R8462:Dnah8 UTSW 17 30,875,603 (GRCm39) missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30,940,108 (GRCm39) missense probably benign
R8524:Dnah8 UTSW 17 30,934,472 (GRCm39) missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30,940,084 (GRCm39) nonsense probably null
R8698:Dnah8 UTSW 17 31,094,009 (GRCm39) missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30,960,289 (GRCm39) missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8781:Dnah8 UTSW 17 30,944,078 (GRCm39) missense probably damaging 1.00
R8821:Dnah8 UTSW 17 31,013,712 (GRCm39) missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30,981,616 (GRCm39) missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30,927,286 (GRCm39) missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 31,070,628 (GRCm39) missense probably damaging 0.98
R8994:Dnah8 UTSW 17 31,009,807 (GRCm39) missense probably benign 0.05
R9031:Dnah8 UTSW 17 30,956,401 (GRCm39) missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30,975,729 (GRCm39) missense possibly damaging 0.63
R9225:Dnah8 UTSW 17 30,854,647 (GRCm39) missense probably benign 0.01
R9280:Dnah8 UTSW 17 31,004,071 (GRCm39) missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30,944,099 (GRCm39) missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30,990,857 (GRCm39) missense probably benign
R9347:Dnah8 UTSW 17 30,927,333 (GRCm39) missense probably benign 0.00
R9393:Dnah8 UTSW 17 30,872,361 (GRCm39) missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 31,029,297 (GRCm39) missense probably benign 0.02
R9458:Dnah8 UTSW 17 31,049,777 (GRCm39) missense probably damaging 1.00
R9465:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9518:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9524:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9564:Dnah8 UTSW 17 30,932,021 (GRCm39) missense probably benign 0.07
R9587:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9599:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9641:Dnah8 UTSW 17 30,932,029 (GRCm39) missense probably benign 0.13
R9674:Dnah8 UTSW 17 30,998,112 (GRCm39) missense possibly damaging 0.84
R9679:Dnah8 UTSW 17 31,037,115 (GRCm39) missense probably benign
R9789:Dnah8 UTSW 17 30,980,104 (GRCm39) critical splice donor site probably null
RF027:Dnah8 UTSW 17 30,854,450 (GRCm39) frame shift probably null
X0001:Dnah8 UTSW 17 30,967,654 (GRCm39) missense probably damaging 1.00
X0013:Dnah8 UTSW 17 31,038,160 (GRCm39) missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30,867,514 (GRCm39) missense probably benign
Z1177:Dnah8 UTSW 17 30,932,069 (GRCm39) missense probably null 1.00
Z1177:Dnah8 UTSW 17 30,913,007 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACACTTGGGTTTGCATCTCTG -3'
(R):5'- ACCTTGACCCCTAATCTGGAAGGAC -3'

Sequencing Primer
(F):5'- TAGGCCATTTCTGCAAGCG -3'
(R):5'- GGAAGGACATCTTTTTTGCTACC -3'
Posted On 2014-05-23