Incidental Mutation 'R1464:Prkg1'
ID 201013
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Name protein kinase, cGMP-dependent, type I
Synonyms Prkgr1b, Prkg1b
MMRRC Submission 039518-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.440) question?
Stock # R1464 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 30541889-31742433 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30556270 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 559 (S559P)
Ref Sequence ENSEMBL: ENSMUSP00000067576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
AlphaFold P0C605
Predicted Effect probably damaging
Transcript: ENSMUST00000065067
AA Change: S559P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: S559P

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073581
AA Change: S574P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: S574P

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183135
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030469F06Rik A G 12: 31,234,914 (GRCm39) noncoding transcript Het
Abca2 T G 2: 25,337,846 (GRCm39) probably benign Het
Adamts8 T A 9: 30,862,673 (GRCm39) W86R probably benign Het
Adh1 A G 3: 137,994,508 (GRCm39) probably null Het
Adipor2 A T 6: 119,338,804 (GRCm39) W150R probably damaging Het
Aff4 T A 11: 53,263,351 (GRCm39) S124T probably damaging Het
Ahnak G T 19: 8,982,260 (GRCm39) K1181N probably damaging Het
Ak2 C A 4: 128,896,152 (GRCm39) probably benign Het
Alkbh5 A G 11: 60,429,873 (GRCm39) I209V probably benign Het
Ankrd11 T C 8: 123,619,463 (GRCm39) E1442G probably damaging Het
Apba2 T A 7: 64,345,297 (GRCm39) D162E probably benign Het
Asic3 G A 5: 24,618,819 (GRCm39) G37E probably damaging Het
AU040320 A T 4: 126,685,824 (GRCm39) K133N possibly damaging Het
C1qtnf7 A G 5: 43,766,481 (GRCm39) S34G probably benign Het
Carf A G 1: 60,165,065 (GRCm39) probably benign Het
Ccdc148 T A 2: 58,796,374 (GRCm39) R463* probably null Het
Ccdc148 T C 2: 58,824,455 (GRCm39) R329G probably damaging Het
Ccdc185 A G 1: 182,576,263 (GRCm39) I142T probably benign Het
Cd274 T C 19: 29,359,992 (GRCm39) probably benign Het
Chrna10 G A 7: 101,763,454 (GRCm39) P114S probably damaging Het
Chst10 A G 1: 38,904,772 (GRCm39) I311T probably damaging Het
Cpne9 T C 6: 113,271,698 (GRCm39) Y353H probably damaging Het
Cubn G T 2: 13,330,099 (GRCm39) A2594E possibly damaging Het
Cyp3a13 T C 5: 137,903,827 (GRCm39) N277S possibly damaging Het
Dctn4 A G 18: 60,671,478 (GRCm39) T117A probably damaging Het
Ddah1 A T 3: 145,559,029 (GRCm39) K96* probably null Het
Ddx5 A C 11: 106,675,711 (GRCm39) D326E probably benign Het
Dlg2 T C 7: 91,617,406 (GRCm39) S323P probably damaging Het
Dnaaf1 C T 8: 120,306,049 (GRCm39) H109Y probably damaging Het
Dnah8 C A 17: 30,914,147 (GRCm39) R1098S possibly damaging Het
Dnajc13 T C 9: 104,091,366 (GRCm39) T642A probably benign Het
Dnajc18 A G 18: 35,813,900 (GRCm39) S290P possibly damaging Het
Dscam T A 16: 96,602,453 (GRCm39) H663L possibly damaging Het
Eefsec C T 6: 88,353,182 (GRCm39) probably benign Het
Emc1 A G 4: 139,098,248 (GRCm39) N740S probably damaging Het
Enpp2 C T 15: 54,727,208 (GRCm39) G541D probably damaging Het
Fam234b C T 6: 135,205,490 (GRCm39) T485I probably benign Het
Fbxl13 A T 5: 21,688,989 (GRCm39) I773K probably benign Het
Fmo4 A G 1: 162,621,924 (GRCm39) F429S possibly damaging Het
Fndc3b A G 3: 27,494,334 (GRCm39) probably benign Het
Frem1 T C 4: 82,930,116 (GRCm39) S277G probably damaging Het
Gaa A G 11: 119,163,810 (GRCm39) I221V probably benign Het
Gnptab A G 10: 88,281,616 (GRCm39) probably benign Het
Gphn T A 12: 78,659,738 (GRCm39) probably benign Het
Helz2 T C 2: 180,881,447 (GRCm39) E345G probably damaging Het
Ifna4 G T 4: 88,760,237 (GRCm39) R47I probably damaging Het
Igsf21 C A 4: 139,761,836 (GRCm39) A281S probably benign Het
Ikzf3 T A 11: 98,407,731 (GRCm39) I37L probably benign Het
Inpp5d A T 1: 87,625,827 (GRCm39) probably benign Het
Jag1 T C 2: 136,957,568 (GRCm39) E48G probably damaging Het
Jarid2 G T 13: 45,001,857 (GRCm39) V57F probably damaging Het
Kcnj4 A G 15: 79,369,605 (GRCm39) L125P probably damaging Het
Kif21b A G 1: 136,083,891 (GRCm39) K713E possibly damaging Het
Layn T A 9: 50,968,886 (GRCm39) S286C probably damaging Het
Lepr T A 4: 101,592,878 (GRCm39) D164E probably benign Het
Macroh2a1 A T 13: 56,230,949 (GRCm39) S310T probably damaging Het
Map3k1 T C 13: 111,892,405 (GRCm39) H950R possibly damaging Het
Map4k5 C A 12: 69,852,124 (GRCm39) V801L possibly damaging Het
Mapkbp1 T A 2: 119,851,742 (GRCm39) S895T probably benign Het
Mthfr T A 4: 148,138,029 (GRCm39) probably benign Het
Naca T A 10: 127,884,157 (GRCm39) M2157K probably damaging Het
Nav2 T C 7: 49,011,952 (GRCm39) I61T probably damaging Het
Nkx2-5 C A 17: 27,058,253 (GRCm39) A234S probably benign Het
Nol8 G A 13: 49,830,264 (GRCm39) S1116N probably benign Het
Nphp3 T C 9: 103,909,078 (GRCm39) probably benign Het
Nppa T C 4: 148,085,304 (GRCm39) S5P probably benign Het
Nup210 A G 6: 91,030,551 (GRCm39) V123A possibly damaging Het
Or13a21 G T 7: 139,999,286 (GRCm39) N133K probably benign Het
Osbpl11 A G 16: 33,049,455 (GRCm39) K604R probably damaging Het
Osbpl1a C T 18: 13,047,615 (GRCm39) S113N probably benign Het
P2rx4 C A 5: 122,852,602 (GRCm39) P92Q probably damaging Het
Pde9a A T 17: 31,692,136 (GRCm39) Q148L probably benign Het
Phf21b T A 15: 84,689,160 (GRCm39) H122L probably damaging Het
Pik3ca T A 3: 32,515,990 (GRCm39) F977I probably damaging Het
Pkd1l3 A G 8: 110,363,059 (GRCm39) probably benign Het
Potefam1 A G 2: 111,055,748 (GRCm39) probably null Het
Pp2d1 T G 17: 53,823,015 (GRCm39) K17T possibly damaging Het
Ppp4r2 A G 6: 100,843,527 (GRCm39) E415G probably damaging Het
Pramel19 T A 4: 101,798,503 (GRCm39) L158Q probably damaging Het
Prss45 A T 9: 110,670,019 (GRCm39) Y276F possibly damaging Het
Ptk7 G T 17: 46,883,517 (GRCm39) N849K probably damaging Het
Rnf121 A G 7: 101,680,782 (GRCm39) I125T possibly damaging Het
Rnf17 A G 14: 56,699,368 (GRCm39) N502S probably damaging Het
Sap25 T A 5: 137,640,622 (GRCm39) Y167* probably null Het
Sdk2 G A 11: 113,720,906 (GRCm39) T1341I possibly damaging Het
Sgcb A G 5: 73,792,896 (GRCm39) V302A probably benign Het
Skor1 T A 9: 63,047,393 (GRCm39) M865L possibly damaging Het
Slc25a45 T C 19: 5,929,928 (GRCm39) probably benign Het
Slc2a3 A G 6: 122,714,269 (GRCm39) probably benign Het
Slc35g1 C A 19: 38,391,665 (GRCm39) L316I probably benign Het
Slco1a8 C T 6: 141,938,243 (GRCm39) W225* probably null Het
Spint4 T A 2: 164,540,568 (GRCm39) L33H probably damaging Het
Sptlc3 A T 2: 139,389,154 (GRCm39) D178V probably benign Het
Stoml1 A G 9: 58,167,709 (GRCm39) probably benign Het
Tbc1d2 T A 4: 46,606,491 (GRCm39) Y818F possibly damaging Het
Tbc1d24 A T 17: 24,400,197 (GRCm39) probably null Het
Teddm2 C T 1: 153,726,277 (GRCm39) W146* probably null Het
Ttn T A 2: 76,589,338 (GRCm39) D12948V probably damaging Het
Txndc8 T C 4: 58,000,274 (GRCm39) T102A probably damaging Het
Uxs1 G A 1: 43,804,076 (GRCm39) Q280* probably null Het
Vmn1r167 T C 7: 23,204,681 (GRCm39) T112A possibly damaging Het
Vmn1r195 A T 13: 22,463,348 (GRCm39) I273L probably benign Het
Vmn1r28 T A 6: 58,242,217 (GRCm39) M20K probably benign Het
Vmn1r53 G A 6: 90,200,914 (GRCm39) L137F probably benign Het
Vmn2r105 G A 17: 20,449,004 (GRCm39) probably benign Het
Vps13b C T 15: 35,709,630 (GRCm39) A1859V probably benign Het
Vwa5b2 A G 16: 20,415,019 (GRCm39) H347R probably benign Het
Wnk2 G A 13: 49,235,451 (GRCm39) P655S probably damaging Het
Zan T G 5: 137,418,191 (GRCm39) D2969A unknown Het
Zbtb24 A G 10: 41,331,075 (GRCm39) H334R probably damaging Het
Zfp108 A G 7: 23,959,973 (GRCm39) D188G probably benign Het
Zfp784 A T 7: 5,038,800 (GRCm39) C253S possibly damaging Het
Zfr T G 15: 12,146,458 (GRCm39) C336W probably damaging Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31,279,740 (GRCm39) missense probably benign 0.02
IGL00481:Prkg1 APN 19 30,549,022 (GRCm39) missense probably benign 0.28
IGL00517:Prkg1 APN 19 30,872,068 (GRCm39) missense probably benign
IGL00782:Prkg1 APN 19 30,556,153 (GRCm39) splice site probably benign
IGL01070:Prkg1 APN 19 30,546,743 (GRCm39) splice site probably benign
IGL01106:Prkg1 APN 19 30,562,678 (GRCm39) missense probably benign 0.05
IGL01783:Prkg1 APN 19 30,602,089 (GRCm39) missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30,970,476 (GRCm39) missense probably benign 0.13
IGL02492:Prkg1 APN 19 30,701,602 (GRCm39) missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30,602,134 (GRCm39) missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31,279,701 (GRCm39) missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30,562,681 (GRCm39) nonsense probably null
IGL03220:Prkg1 APN 19 30,546,637 (GRCm39) utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31,641,596 (GRCm39) missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30,572,378 (GRCm39) missense probably benign
R1099:Prkg1 UTSW 19 30,549,012 (GRCm39) missense probably benign
R1464:Prkg1 UTSW 19 30,556,270 (GRCm39) missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30,602,143 (GRCm39) missense probably benign
R1738:Prkg1 UTSW 19 30,764,322 (GRCm39) missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31,563,095 (GRCm39) missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31,641,542 (GRCm39) missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30,556,260 (GRCm39) missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30,556,031 (GRCm39) missense probably benign 0.27
R3009:Prkg1 UTSW 19 31,641,512 (GRCm39) missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31,562,978 (GRCm39) missense probably damaging 1.00
R4355:Prkg1 UTSW 19 30,546,629 (GRCm39) utr 3 prime probably benign
R4652:Prkg1 UTSW 19 30,572,412 (GRCm39) missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31,641,639 (GRCm39) missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31,641,579 (GRCm39) nonsense probably null
R4789:Prkg1 UTSW 19 31,563,045 (GRCm39) missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31,742,006 (GRCm39) missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30,563,775 (GRCm39) missense probably benign 0.37
R5625:Prkg1 UTSW 19 31,742,162 (GRCm39) missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31,563,072 (GRCm39) missense probably benign 0.02
R5855:Prkg1 UTSW 19 30,872,094 (GRCm39) missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31,563,097 (GRCm39) missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30,701,556 (GRCm39) splice site probably null
R5968:Prkg1 UTSW 19 30,570,324 (GRCm39) missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30,546,651 (GRCm39) missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30,758,746 (GRCm39) missense probably benign 0.21
R6702:Prkg1 UTSW 19 30,970,484 (GRCm39) missense probably benign 0.00
R6750:Prkg1 UTSW 19 31,741,961 (GRCm39) missense probably benign 0.41
R6894:Prkg1 UTSW 19 30,602,174 (GRCm39) nonsense probably null
R7155:Prkg1 UTSW 19 31,279,701 (GRCm39) missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30,562,599 (GRCm39) missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30,602,090 (GRCm39) missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30,556,235 (GRCm39) missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30,970,491 (GRCm39) missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30,602,170 (GRCm39) missense possibly damaging 0.92
R7804:Prkg1 UTSW 19 30,556,032 (GRCm39) missense probably benign 0.00
R7893:Prkg1 UTSW 19 30,563,767 (GRCm39) missense probably damaging 0.99
R8304:Prkg1 UTSW 19 30,701,584 (GRCm39) missense possibly damaging 0.75
R8497:Prkg1 UTSW 19 31,279,709 (GRCm39) missense probably damaging 1.00
R8676:Prkg1 UTSW 19 31,742,146 (GRCm39) missense probably damaging 0.98
R9318:Prkg1 UTSW 19 30,549,038 (GRCm39) missense probably benign 0.09
R9694:Prkg1 UTSW 19 30,764,371 (GRCm39) missense possibly damaging 0.84
X0011:Prkg1 UTSW 19 30,970,521 (GRCm39) missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31,279,773 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTAACCTCTCTGATGGGTTGTCCCTAA -3'
(R):5'- GCTTTGCTCAACAATGACTTGTGCT -3'

Sequencing Primer
(F):5'- CTCTGATGGGTTGTCCCTAAAAATG -3'
(R):5'- CTCAACAATGACTTGTGCTTTGTTAG -3'
Posted On 2014-05-23